Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK03391
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB290179
Product ID ORK03391
Clone name sh03709s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MYO1G
cDNA sequence DNA sequence (3234 bp)
Predicted protein sequence (1026 aa)
Flexi ORF Clone FXC03391
Description myosin IG
Features of the cloned cDNA sequence

Length: 3234 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 73 bp
Genome contig ID gi89161213r_44868790
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CGCCCCGCCAGCGCTGCAAATAAACCTTCTGAGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCCTCCTGCTCGCCGCTCCCGCCTCACCCGCAGGGGCTCCGGCCGCCT

Features of the protein sequence

Length: 1026 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
B0I1T2 0 100.0 Myosin-Ig; Cont...
Homo sapiens
NP_149043 0 99.8 myosin-Ig [Homo...
Homo sapiens
XP_519077 0 98.7 myosin IG isofo...
Pan troglodytes
XP_001149108 0 98.2 myosin IG isofo...
Pan troglodytes
XP_001149187 0 98.3 myosin IG isofo...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001609 146 173 PD000355 Myosin head
FPrintScan IPR001609 47 66 PR00193 Myosin head
IPR001609 103 128 PR00193 Myosin head
IPR001609 151 178 PR00193 Myosin head
IPR001609 398 426 PR00193 Myosin head
IPR001609 451 479 PR00193 Myosin head
HMMPfam IPR001609 19 702 PF00063 Myosin head
IPR010926 822 1025 PF06017 Myosin tail 2
HMMSmart IPR001609 11 716 SM00242 Myosin head
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp