Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04002
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209790
Product ID ORK04002
Clone name bm02973
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol AAMP
cDNA sequence DNA sequence (2270 bp)
Predicted protein sequence (233 aa)
Description Angio-associated migratory cell protein.
Features of the cloned cDNA sequence

Length: 2270 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1566 bp
Genome contig ID gi89161199r_218737097
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGATTTTAAAAATGTAAATAAAATATACTTCCCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGACAGAGTCTGTGTGGATTTTGTGATGGCTGGACCCTAGGAGGAGCTAG

Features of the protein sequence

Length: 233 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93027 1.9e-94 100.0 angio-associate...
Homo sapiens
Q13685 2.7e-92 99.5 Angio-associate...
Homo sapiens
Q5RCG7 2.7e-92 99.5 Angio-associate...
Pongo abelii
CAH91392 2.7e-92 99.5 hypothetical pr...
Pongo abelii
XP_516086 2.7e-92 99.5 angio-associate...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 81 120 PF00400 WD40 repeat
IPR001680 124 162 PF00400 WD40 repeat
HMMSmart IPR001680 80 120 SM00320 WD40 repeat
IPR001680 123 162 SM00320 WD40 repeat
IPR001680 165 202 SM00320 WD40 repeat
ProfileScan IPR001680 87 129 PS50082 WD40 repeat
IPR001680 87 171 PS50294 WD40 repeat
IPR001680 130 171 PS50082 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp