Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04048
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209891
Product ID ORK04048
Clone name eg01092
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ADAR
cDNA sequence DNA sequence (6259 bp)
Predicted protein sequence (1244 aa)
Description Double-stranded RNA-specific adenosine deaminase (EC 3.5.4.-) (DRADA) (136 kDa double-stranded RNA-binding protein) (P136) (K88DSRBP) (Interferon-inducible protein 4) (IFI-4 protein).
Features of the cloned cDNA sequence

Length: 6259 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2523 bp
Genome contig ID gi89161185r_152721392
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
GTGCATTCCTTGAATAATCACTTGTAAAAATTGTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGTGCTTGAAGCTGTTTCCTTTACTCACATTGAAGGGACTTCGTTGGTTT

Features of the protein sequence

Length: 1244 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93128 0 100.0 adenosine deami...
 Homo sapiens
CAD98075 0 100.0 hypothetical pr...
 Homo sapiens
CAE45853 0 99.5 hypothetical pr...
 Homo sapiens
P55265 0 100.0 Double-stranded...
 Homo sapiens
AAB06697 0 99.9 double-stranded...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000607 153 219 PF02295 Double-stranded RNA-specific adenosine deaminase (DRADA)
IPR000607 313 377 PF02295 Double-stranded RNA-specific adenosine deaminase (DRADA)
IPR001159 522 587 PF00035 Double-stranded RNA binding
IPR001159 633 698 PF00035 Double-stranded RNA binding
IPR001159 745 810 PF00035 Double-stranded RNA binding
IPR002466 904 1235 PF02137 Adenosine deaminase/editase
HMMSmart IPR000607 150 219 SM00550 Double-stranded RNA-specific adenosine deaminase (DRADA)
IPR000607 309 377 SM00550 Double-stranded RNA-specific adenosine deaminase (DRADA)
IPR001159 522 588 SM00358 Double-stranded RNA binding
IPR001159 633 699 SM00358 Double-stranded RNA binding
IPR001159 745 811 SM00358 Double-stranded RNA binding
IPR002466 857 1240 SM00552 Adenosine deaminase/editase
ProfileScan IPR000607 151 220 PS50139 Double-stranded RNA-specific adenosine deaminase (DRADA)
IPR000607 311 378 PS50139 Double-stranded RNA-specific adenosine deaminase (DRADA)
IPR001159 521 589 PS50137 Double-stranded RNA binding
IPR001159 632 700 PS50137 Double-stranded RNA binding
IPR001159 744 812 PS50137 Double-stranded RNA binding
IPR002466 904 1239 PS50141 Adenosine deaminase/editase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp