ORK04073

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04073

Order Kazusa clone(s) from :

Accession No	AB209414
Product ID	ORK04073
Clone name	fh27679
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	AKAP13
cDNA sequence	DNA sequence (5410 bp) Predicted protein sequence (1308 aa)
Description	A-kinase anchor protein 13 (AKAP 13) (Protein kinase A-anchoring protein 13) (Breast cancer nuclear receptor-binding auxiliary protein) (Human thyroid-anchoring protein 31) (Guanine nucleotide exchange factor Lbc) (AKAP-Lbc) (LBC oncogene) (P47) (Lymphoid

Features of the cloned cDNA sequence

Description

Length: 5410 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1481 bp
Genome contig ID	gi51511731f_83899731
PolyA signal sequence (None)	+--------+--------+----*----+---- TGCCCCTCAGAAGCATGGGGCTTTTGAGCACACTT
Flanking genome sequence (190664 - 190713)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAATCTGTAACTTGGTGCTTATTGATGAATTGCAAGCTGG

Features of the protein sequence

Description

Length: 1308 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92651	100.0	A-kinase anchor...	Homo sapiens
XP_001163801	99.6	A-kinase anchor...	Pan troglodytes
XP_001163360	99.6	A-kinase anchor...	Pan troglodytes
AAL11723	98.1	A-kinase anchor...	Homo sapiens
EAX01975	98.0	A kinase (PRKA)...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	289	339	PF00130	Protein kinase C
	IPR000219	493	685	PF00621	DH
	IPR001849	727	828	PF00169	Pleckstrin-like
HMMSmart	IPR002219	289	335	SM00109	Protein kinase C
	IPR000219	493	685	SM00325	DH
	IPR001849	727	830	SM00233	Pleckstrin-like
ProfileScan	IPR002219	288	335	PS50081	Protein kinase C
	IPR000219	489	686	PS50010	DH
	IPR001849	726	828	PS50003	Pleckstrin-like
ScanRegExp	IPR002219	289	335	PS00479	Protein kinase C
ScanRegExp	IPR002048	449	461	PS00018	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp