ORK04089

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04089

Order Kazusa clone(s) from :

Accession No	AB209814
Product ID	ORK04089
Clone name	bm04379
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ALPL
cDNA sequence	DNA sequence (2574 bp) Predicted protein sequence (602 aa)
HaloTag ORF Clone	FHC04089
Flexi ORF Clone	FXC04089
Description	Alkaline phosphatase, tissue-nonspecific isozyme precursor (EC 3.1.3.1) (AP-TNAP) (TNSALP) (Alkaline phosphatase liver/bone/kidney isozyme).

Features of the cloned cDNA sequence

Description

Length: 2574 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	763 bp
Genome contig ID	gi89161185f_21608466
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- CATTTAAATAAAACTTTCCAAATATTTCCGAGGAC
Flanking genome sequence (169027 - 169076)	----+--------+--------+--------+--------+----* AGAGCTGAGTCTTTGTGGTCAGTGAGAAAAAGACTGAAAGAAGCTTATTT

Features of the protein sequence

Description

Length: 602 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD93051	100.0	ALPL protein va...	Homo sapiens
XP_001109717	96.1	tissue non-spec...	Macaca mulatta
P05186	99.8	Alkaline phosph...	Homo sapiens
AAI26166	99.6	Alkaline phosph...	Homo sapiens
BAG35549	99.4	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001952	129	149	PR00113	Alkaline phosphatase
	IPR001952	185	200	PR00113	Alkaline phosphatase
	IPR001952	232	252	PR00113	Alkaline phosphatase
	IPR001952	292	302	PR00113	Alkaline phosphatase
	IPR001952	386	415	PR00113	Alkaline phosphatase
HMMPfam	IPR001952	123	486	PF00245	Alkaline phosphatase
HMMSmart	IPR001952	130	569	SM00098	Alkaline phosphatase
ScanRegExp	IPR001952	185	193	PS00123	Alkaline phosphatase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	581	AGSLAAGPLLLALALYPLSVLF	602	PRIMARY	22