ORK04148

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04148

Order Kazusa clone(s) from :

Accession No	AB208831
Product ID	ORK04148
Clone name	ph00232
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARAF
cDNA sequence	DNA sequence (5548 bp) Predicted protein sequence (188 aa)
Description	A-Raf proto-oncogene serine/threonine-protein kinase (EC 2.7.11.1) (A- raf-1) (Proto-oncogene Pks).

Features of the cloned cDNA sequence

Description

Length: 5548 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4879 bp
Genome contig ID	gi89161218f_47205546
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCTTTCTTCACCAAGAAGCACAGAATTCTGCTGG
Flanking genome sequence (110705 - 110754)	----+--------+--------+--------+--------+----* GCCTTTGCTTGTTTATTTTGTTTCCCGACTCTTCTCTTGGGGTTCAGAGC

Features of the protein sequence

Description

Length: 188 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92068	2.2e-82	100.0	v-raf murine sa...	Homo sapiens
CAI42469	1.7e-81	100.0	v-raf murine sa...	Homo sapiens
XP_001094692	4.2e-81	100.0	v-raf murine sa...	Macaca mulatta
XP_001094928	4.2e-81	100.0	v-raf murine sa...	Macaca mulatta
BAG59877	5.3e-81	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	98	112	PR00008	Protein kinase C
	IPR002219	114	123	PR00008	Protein kinase C
	IPR002219	123	134	PR00008	Protein kinase C
	IPR002219	135	147	PR00008	Protein kinase C
HMMPfam	IPR003116	21	93	PF02196	Raf-like Ras-binding
HMMPfam	IPR002219	101	149	PF00130	Protein kinase C
HMMSmart	IPR003116	21	93	SM00455	Raf-like Ras-binding
HMMSmart	IPR002219	101	146	SM00109	Protein kinase C
ProfileScan	IPR003116	21	93	PS50898	Raf-like Ras-binding
ProfileScan	IPR002219	100	146	PS50081	Protein kinase C
ScanRegExp	IPR002219	101	146	PS00479	Protein kinase C

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp