Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04159
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208792
Product ID ORK04159
Clone name fg02027
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ARHGAP6
cDNA sequence DNA sequence (6299 bp)
Predicted protein sequence (729 aa)
Description Rho GTPase-activating protein 6 (Rho-type GTPase-activating protein RhoGAPX-1).
Features of the cloned cDNA sequence

Length: 6299 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4067 bp
Genome contig ID gi89161218r_10965588
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TTCTATCTTGTGCCATGATGAATAAAAAGTTAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGGCTTTGTTTCCTGGCTTTAAATCTCTTGAATGAATTTGCATCACAT

Features of the protein sequence

Length: 729 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92029 0 100.0 Rho GTPase acti...
Homo sapiens
NP_006116 1.5e-213 98.9 rho GTPase-acti...
Homo sapiens
AAI50636 1.8e-213 98.9 Rho GTPase acti...
Homo sapiens
O43182 1.8e-213 98.9 Rho GTPase-acti...
Homo sapiens
AAC98539 3.2e-213 98.7 Rho GTPase acti...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000198 482 641 PF00620 RhoGAP
HMMSmart IPR000198 479 670 SM00324 RhoGAP
ProfileScan IPR000198 472 673 PS50238 RhoGAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp