Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04194
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226086
Product ID ORK04194
Clone name bm03735
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ASPSCR1
cDNA sequence DNA sequence (1714 bp)
Predicted protein sequence (543 aa)
Description Tether containing UBX domain for GLUT4 (Alveolar soft part sarcoma chromosome region candidate 1) (Alveolar soft part sarcoma locus) (Renal papillary cell carcinoma protein 17).
Features of the cloned cDNA sequence

Length: 1714 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 82 bp
Genome contig ID gi51511734f_77428842
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTCTGCCAGCAGGAATAAAGACTTGTGCATCCCTC
Flanking genome sequence
(139729 - 139778)
----+----*----+----*----+----*----+----*----+----*
AACGCCTTCCTGTCATGCTTCCTCCAGAAAAGGGCCCCCGTCGTCTGCCC

Features of the protein sequence

Length: 543 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH18722 1.4e-171 100.0 Alveolar soft p...
Homo sapiens
Q9BZE9 3.7e-171 99.8 Tether containi...
Homo sapiens
XP_001166432 1.9e-158 96.9 similar to alve...
Pan troglodytes
XP_523749 1e-143 96.6 similar to alve...
Pan troglodytes
BAB71472 5e-139 85.0 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001012 375 454 PF00789 UBX
ProfileScan IPR001012 376 452 PS50033 UBX
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp