Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04223
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208828
Product ID ORK04223
Clone name hj01066
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ATP7A
cDNA sequence DNA sequence (5296 bp)
Predicted protein sequence (682 aa)
Description Copper-transporting ATPase 1 (EC 3.6.3.4) (Copper pump 1) (Menkes disease-associated protein).
Features of the cloned cDNA sequence

Length: 5296 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3176 bp
Genome contig ID gi89161218f_76952909
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGACCAGCCTGGGCAACATATCAAGACTGTCTCTT
Flanking genome sequence
(201836 - 201885)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAGGAAGAAATATCTGATTTTCCTTGTATTAT

Features of the protein sequence

Length: 682 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92065 0 100.0 ATPase, Cu++ tr...
Homo sapiens
CAA49145 0 100.0 heavy metal bin...
Homo sapiens
Q04656 0 100.0 Copper-transpor...
Homo sapiens
CAI42806 0 100.0 ATPase, Cu++ tr...
Homo sapiens
EAW98606 0 100.0 ATPase, Cu++ tr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001802 16 27 PR00946 Mercury scavenger protein
IPR001802 27 43 PR00946 Mercury scavenger protein
IPR001877 30 48 PR00942 Copper-transporting ATPase 1
IPR001802 43 58 PR00946 Mercury scavenger protein
IPR001877 48 65 PR00942 Copper-transporting ATPase 1
IPR001802 72 86 PR00946 Mercury scavenger protein
IPR001877 499 524 PR00942 Copper-transporting ATPase 1
IPR001877 525 548 PR00942 Copper-transporting ATPase 1
IPR001877 554 574 PR00942 Copper-transporting ATPase 1
IPR001877 598 619 PR00942 Copper-transporting ATPase 1
HMMPfam IPR006121 21 85 PF00403 Heavy metal transport/detoxification protein
IPR006121 184 248 PF00403 Heavy metal transport/detoxification protein
IPR006121 290 354 PF00403 Heavy metal transport/detoxification protein
IPR006121 390 454 PF00403 Heavy metal transport/detoxification protein
IPR006121 501 565 PF00403 Heavy metal transport/detoxification protein
IPR006121 577 641 PF00403 Heavy metal transport/detoxification protein
HMMTigr IPR006122 19 84 TIGR00003 Copper ion-binding
IPR006122 499 564 TIGR00003 Copper ion-binding
ProfileScan IPR006121 19 85 PS50846 Heavy metal transport/detoxification protein
IPR006121 182 248 PS50846 Heavy metal transport/detoxification protein
IPR006121 288 354 PS50846 Heavy metal transport/detoxification protein
IPR006121 388 454 PS50846 Heavy metal transport/detoxification protein
IPR006121 499 565 PS50846 Heavy metal transport/detoxification protein
IPR006121 575 633 PS50846 Heavy metal transport/detoxification protein
ScanRegExp IPR006121 24 53 PS01047 Heavy metal transport/detoxification protein
IPR006121 187 216 PS01047 Heavy metal transport/detoxification protein
IPR006121 293 322 PS01047 Heavy metal transport/detoxification protein
IPR006121 393 422 PS01047 Heavy metal transport/detoxification protein
IPR006121 504 533 PS01047 Heavy metal transport/detoxification protein
IPR006121 580 609 PS01047 Heavy metal transport/detoxification protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp