ORK04371

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04371

Order Kazusa clone(s) from :

Accession No	AB209578
Product ID	ORK04371
Clone name	sj01773
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	C21orf2
cDNA sequence	DNA sequence (4528 bp) Predicted protein sequence (218 aa)
Description	Uncharacterized protein C21orf2 (C21orf-HUMF09G8.5) (YF5/A2).

Features of the cloned cDNA sequence

Description

Length: 4528 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1819 bp
Genome contig ID	gi51511750r_44474195
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- CTCCCTAATAAAAGATTTTCCCAAGGTTGATCTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGTGACGTTTCCCAAGGCATGGTTGTGACAGTCTTCCTGAAAGCAAGGG

Features of the protein sequence

Description

Length: 218 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92815	3.1e-93	100.0	C21orf2 protein...	Homo sapiens
EAX09433	6.7e-53	92.5	chromosome 21 o...	Homo sapiens
O43822	6.7e-53	92.5	Uncharacterized...	Homo sapiens
AAH31300	9e-53	92.5	C21orf2 protein...	Homo sapiens
EAX09431	1.1e-52	100.0	chromosome 21 o...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003603	140	158	SM00446	U2A'/phosphoprotein 32 family A

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp