Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04371
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209578
Product ID ORK04371
Clone name sj01773
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol C21orf2
cDNA sequence DNA sequence (4528 bp)
Predicted protein sequence (218 aa)
Description Uncharacterized protein C21orf2 (C21orf-HUMF09G8.5) (YF5/A2).
Features of the cloned cDNA sequence

Length: 4528 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1819 bp
Genome contig ID gi51511750r_44474195
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
CTCCCTAATAAAAGATTTTCCCAAGGTTGATCTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGGTGACGTTTCCCAAGGCATGGTTGTGACAGTCTTCCTGAAAGCAAGGG

Features of the protein sequence

Length: 218 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92815 3.1e-93 100.0 C21orf2 protein...
Homo sapiens
EAX09433 6.7e-53 92.5 chromosome 21 o...
Homo sapiens
O43822 6.7e-53 92.5 Uncharacterized...
Homo sapiens
AAH31300 9e-53 92.5 C21orf2 protein...
Homo sapiens
EAX09431 1.1e-52 100.0 chromosome 21 o...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR003603 140 158 SM00446 U2A'/phosphoprotein 32 family A
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp