Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04417
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208917
Product ID ORK04417
Clone name hk04943
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CACNB2
cDNA sequence DNA sequence (4468 bp)
Predicted protein sequence (616 aa)
Description Voltage-dependent L-type calcium channel subunit beta-2 (CAB2) (Calcium channel voltage-dependent subunit beta 2) (Lambert-Eaton myasthenic syndrome antigen B) (MYSB).
Features of the cloned cDNA sequence

Length: 4468 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2149 bp
Genome contig ID gi89161187f_18489704
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CTGGGTGACAGAGTGAGACTCCATCTCCAAAAAAG
Flanking genome sequence
(381102 - 381151)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAACAAAAAACAAAAAAAACTATCCAGCAAAATTATAAAATCTA

Features of the protein sequence

Length: 616 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92154 0 100.0 calcium channel...
 Homo sapiens
CAH71350 0 100.0 calcium channel...
 Homo sapiens
AAK16994 0 99.8 voltage-depende...
 Homo sapiens
AAL16948 0 99.8 calcium channel...
 Homo sapiens
XP_001093855 0 99.3 calcium channel...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR005444 80 94 PR01628 L-type calcium channel beta 2 subunit
IPR005444 145 159 PR01628 L-type calcium channel beta 2 subunit
IPR005444 181 194 PR01628 L-type calcium channel beta 2 subunit
IPR005444 195 208 PR01628 L-type calcium channel beta 2 subunit
IPR000584 230 244 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR000584 245 259 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR000584 260 275 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR000584 276 290 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR000584 309 323 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR000584 324 339 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR000584 342 358 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR000584 363 378 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR000584 379 390 PR01626 Dihydropyridine sensitive L-type calcium channel
IPR005444 456 470 PR01628 L-type calcium channel beta 2 subunit
HMMPfam IPR001452 73 136 PF00018 Src homology-3
IPR000584 233 457 PF00774 Dihydropyridine sensitive L-type calcium channel
HMMSmart IPR001452 73 137 SM00326 Src homology-3
IPR008145 236 417 SM00072 Guanylate kinase/L-type calcium channel region
ProfileScan IPR001452 70 131 PS50002 Src homology-3
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp