Length: 5953 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
409 bp |
Genome contig ID |
gi89161187r_75144064 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- GTCTCTGCTGTACTGAGGTGTTTTTTACATTTAAG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAGAAAAAAAGATTGTTTAAAAAAAAAAGGAATCCATACC |
Length: 155 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92711 |
1.7e-65 |
100.0 |
calcium/calmodu...
|
Homo sapiens
|
AAL69958 |
2.4e-37 |
71.7 |
CaM kinase II g...
|
Mustela putoriu...
|
AAC48714 |
1.2e-34 |
75.0 |
calcium/calmodu...
|
Sus scrofa
|
XP_863725 |
1.2e-34 |
75.0 |
similar to calc...
|
Canis lupus fam...
|
EAW54533 |
4.1e-34 |
81.5 |
calcium/calmodu...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR013543 |
84 |
154 |
PF08332 |
Calcium/calmodulin dependent protein kinase II |
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
5 |
CLLEMAGGQASVVIIGSAGVLGC |
27 |
PRIMARY |
23 |