Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04484
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208829
Product ID ORK04484
Clone name hk01154
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CCNF
cDNA sequence DNA sequence (4087 bp)
Predicted protein sequence (701 aa)
Description G2/mitotic-specific cyclin-F.
Features of the cloned cDNA sequence

Length: 4087 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1831 bp
Genome contig ID gi51511732f_2321131
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
GGGTGTTGTGAGGATTAAATGTGAGGAGGATAGTG
Flanking genome sequence
(127724 - 127773)
----+----*----+----*----+----*----+----*----+----*
GCAGATGAGTGATGGACGTCCTTCACTGCCTCGGCCCCTTGTCCAGGGGC

Features of the protein sequence

Length: 701 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92066 0 100.0 G2/mitotic-spec...
Homo sapiens
P41002 0 98.7 G2/mitotic-spec...
Homo sapiens
AAX29848 0 98.7 cyclin F [synth...
synthetic construct
XP_510746 0 98.5 cyclin F [Pan t...
Pan troglodytes
BAG36170 0 98.5 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006671 196 321 PF00134 Cyclin
IPR004367 323 450 PF02984 Cyclin
HMMSmart IPR006670 230 314 SM00385 Cyclin
IPR006670 331 409 SM00385 Cyclin
ScanRegExp IPR006671 225 256 PS00292 Cyclin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp