Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04485
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209766
Product ID ORK04485
Clone name bm00977
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CCNI
cDNA sequence DNA sequence (1873 bp)
Predicted protein sequence (384 aa)
Description Cyclin-I.
Features of the cloned cDNA sequence

Length: 1873 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 193 bp
Genome contig ID gi89161207r_78088203
PolyA signal sequence
(CATAAA,-10)		 
+----*----+----*----+----*----+----
ATTATAATTCAGCGTTATTTAAGCACATAAAGACC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGAAATCCAAAAGATCCAAACTTTTTTTAAACTTAAA

Features of the protein sequence

Length: 384 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93003 9.1e-170 100.0 CCNI protein va...
 Homo sapiens
CAG46582 3.6e-166 99.7 CCNI [Homo sapi...
 Homo sapiens
Q14094 1.3e-165 99.7 Cyclin-I.
 Homo sapiens
AAV38820 1.3e-165 99.7 cyclin I [synth...
 synthetic construct
XP_001148321 3.4e-165 99.2 cyclin I isofor...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006671 35 150 PF00134 Cyclin
HMMSmart IPR006670 57 143 SM00385 Cyclin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp