ORK04511

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04511

Order Kazusa clone(s) from :

Accession No	AB209337
Product ID	ORK04511
Clone name	fh12209
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CDC7
cDNA sequence	DNA sequence (5305 bp) Predicted protein sequence (326 aa)
Description	Cell division cycle 7-related protein kinase (EC 2.7.11.1) (CDC7- related kinase) (HsCdc7) (huCdc7).

Features of the cloned cDNA sequence

Description

Length: 5305 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3555 bp
Genome contig ID	gi89161185f_91639021
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTGAATTTGTATATTCAATAAAGTTATCCTTTTAT
Flanking genome sequence (124882 - 124931)	----+--------+--------+--------+--------+----* ATTTTTTATGTCAGACTACTCATTTGAAAAATAGCTTTTTTTTTTAATTG

Features of the protein sequence

Description

Length: 326 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92574	6.6e-126	100.0	CDC7 cell divis...	Homo sapiens
O00311	1e-102	96.5	Cell division c...	Homo sapiens
AAB97512	1.8e-102	96.1	HsCdc7 [Homo sa...	Homo sapiens
BAG35599	3.6e-102	96.1	unnamed protein...	Homo sapiens
XP_001097186	4.1e-101	94.7	CDC7 cell divis...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	82	228	PD000001	Protein kinase
HMMPfam	IPR000719	82	224	PF00069	Protein kinase
HMMSmart	IPR001245	82	324	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	82	316	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	82	326	PS50011	Protein kinase
ScanRegExp	IPR000719	88	114	PS00107	Protein kinase
ScanRegExp	IPR008271	197	209	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp