Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04515
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209829
Product ID ORK04515
Clone name bm05103
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CDK10
cDNA sequence DNA sequence (2164 bp)
Predicted protein sequence (214 aa)
Description Cell division protein kinase 10 (EC 2.7.11.22) (Serine/threonine- protein kinase PISSLRE).
Features of the cloned cDNA sequence

Length: 2164 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1443 bp
Genome contig ID gi51511732f_88180597
PolyA signal sequence
(GATAAA,-20)
+----*----+----*----+----*----+----
TATAGGCTCTTGTTGGATAAAAGCTTTTTTAACAG
Flanking genome sequence
(109667 - 109716)
----+----*----+----*----+----*----+----*----+----*
ACATGGTTTCACCAGCGTTTAATGTGCTCTGATGTTGACCGTCCCTCTGA

Features of the protein sequence

Length: 214 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93066 3.5e-84 100.0 cyclin-dependen...
Homo sapiens
EAW66705 1.3e-43 96.2 cyclin-dependen...
Homo sapiens
AAA60092 1.6e-43 88.4 CDC2-related pr...
Homo sapiens
NP_001092003 1.7e-43 88.4 cyclin-dependen...
Homo sapiens
EAW66709 1.7e-43 88.4 cyclin-dependen...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 6 152 PD000001 Protein kinase
HMMPfam IPR000719 13 136 PF00069 Protein kinase
HMMSmart IPR001245 5 161 SM00219 Tyrosine protein kinase
IPR002290 5 163 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 1 214 PS50011 Protein kinase
ScanRegExp IPR008271 117 129 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp