Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04543
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226113
Product ID ORK04543
Clone name hg03448
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CFH
cDNA sequence DNA sequence (6981 bp)
Predicted protein sequence (708 aa)
Description Complement factor H precursor (H factor 1).
Features of the cloned cDNA sequence

Length: 6981 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1997 bp
Genome contig ID gi89161185f_194812741
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
CTTCTTAAAAGCACCATATTAAATCCTGGAAAACT
Flanking genome sequence
(170516 - 170565)
----+----*----+----*----+----*----+----*----+----*
AACGGTTGTGTCCAGTTCATAAAATGTTTGTGGCAAGAAATTAGACGCAA

Features of the protein sequence

Length: 708 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
ABB02180 0 97.4 complement fact...
Homo sapiens
P08603 0 97.4 Complement fact...
Homo sapiens
CAI19672 0 97.3 complement fact...
Homo sapiens
1HAQ 0 97.1 COMPLEMENT FACTOR H
Homo sapiens
CAA68704 0 97.1 factor H [Homo ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000436 44 104 PF00084 Sushi/SCR/CCP
IPR000436 108 161 PF00084 Sushi/SCR/CCP
IPR000436 167 224 PF00084 Sushi/SCR/CCP
IPR000436 228 283 PF00084 Sushi/SCR/CCP
IPR000436 288 342 PF00084 Sushi/SCR/CCP
IPR000436 349 403 PF00084 Sushi/SCR/CCP
IPR000436 410 463 PF00084 Sushi/SCR/CCP
IPR000436 472 522 PF00084 Sushi/SCR/CCP
IPR000436 530 583 PF00084 Sushi/SCR/CCP
IPR000436 589 645 PF00084 Sushi/SCR/CCP
IPR000436 650 703 PF00084 Sushi/SCR/CCP
HMMSmart IPR000436 44 104 SM00032 Sushi/SCR/CCP
IPR000436 108 161 SM00032 Sushi/SCR/CCP
IPR000436 167 224 SM00032 Sushi/SCR/CCP
IPR000436 228 283 SM00032 Sushi/SCR/CCP
IPR000436 288 342 SM00032 Sushi/SCR/CCP
IPR000436 349 403 SM00032 Sushi/SCR/CCP
IPR000436 410 463 SM00032 Sushi/SCR/CCP
IPR000436 472 522 SM00032 Sushi/SCR/CCP
IPR000436 530 583 SM00032 Sushi/SCR/CCP
IPR000436 589 645 SM00032 Sushi/SCR/CCP
IPR000436 650 703 SM00032 Sushi/SCR/CCP
ProfileScan IPR000436 106 163 PS50923 Sushi/SCR/CCP
IPR000436 165 226 PS50923 Sushi/SCR/CCP
IPR000436 234 285 PS50923 Sushi/SCR/CCP
IPR000436 286 344 PS50923 Sushi/SCR/CCP
IPR000436 347 405 PS50923 Sushi/SCR/CCP
IPR000436 408 465 PS50923 Sushi/SCR/CCP
IPR000436 470 524 PS50923 Sushi/SCR/CCP
IPR000436 528 585 PS50923 Sushi/SCR/CCP
IPR000436 587 647 PS50923 Sushi/SCR/CCP
IPR000436 648 705 PS50923 Sushi/SCR/CCP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp