Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04605
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209864
Product ID ORK04605
Clone name ef03277
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol COL5A1
cDNA sequence DNA sequence (7621 bp)
Predicted protein sequence (1792 aa)
Description Collagen alpha-1(V) chain precursor.
Features of the cloned cDNA sequence

Length: 7621 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2242 bp
Genome contig ID gi89161216f_136622608
PolyA signal sequence
(AATAAA,-26)		 
+----*----+----*----+----*----+----
GTATATTGCAATAAAATTACTTCTTATATTTGCAG
Flanking genome sequence
(253606 - 253655)		 
----+----*----+----*----+----*----+----*----+----*
AAATTCTTTTGGTGTAATTTTATTTTTTCCTCTCAATATATATAATTGGA

Features of the protein sequence

Length: 1792 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93101 0 100.0 Pro-alpha-1 typ...
 Homo sapiens
P20908 0 100.0 Collagen alpha-...
 Homo sapiens
BAG48312 0 99.9 collagen type V...
 Homo sapiens
AAA59993 0 99.7 pro-alpha-1 typ...
 Homo sapiens
EAW88132 0 99.6 collagen, type ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR008161 574 596 PD000007 Collagen helix repeat
IPR008161 881 902 PD000007 Collagen helix repeat
IPR008161 993 1024 PD000007 Collagen helix repeat
IPR008161 1376 1401 PD000007 Collagen helix repeat
IPR008161 1450 1474 PD000007 Collagen helix repeat
IPR000885 1682 1791 PD002078 Fibrillar collagen
HMMPfam IPR012680 60 183 PF02210 Laminin G
IPR008160 423 471 PF01391 Collagen triple helix repeat
IPR008160 511 566 PF01391 Collagen triple helix repeat
IPR008160 567 626 PF01391 Collagen triple helix repeat
IPR008160 627 686 PF01391 Collagen triple helix repeat
IPR008160 687 746 PF01391 Collagen triple helix repeat
IPR008160 750 805 PF01391 Collagen triple helix repeat
IPR008160 807 866 PF01391 Collagen triple helix repeat
IPR008160 867 926 PF01391 Collagen triple helix repeat
IPR008160 927 986 PF01391 Collagen triple helix repeat
IPR008160 999 1058 PF01391 Collagen triple helix repeat
IPR008160 1080 1139 PF01391 Collagen triple helix repeat
IPR008160 1140 1199 PF01391 Collagen triple helix repeat
IPR008160 1263 1322 PF01391 Collagen triple helix repeat
IPR008160 1377 1436 PF01391 Collagen triple helix repeat
IPR008160 1446 1505 PF01391 Collagen triple helix repeat
IPR000885 1579 1790 PF01410 Fibrillar collagen
HMMSmart IPR003129 1 184 SM00210 Laminin G
IPR001791 52 183 SM00282 Laminin G
IPR000885 1562 1791 SM00038 Fibrillar collagen
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp