ORK04625

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04625

Order Kazusa clone(s) from :

Accession No
Product ID	ORK04625
Clone name	ef03452
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CREB3L2
cDNA sequence	DNA sequence (7425 bp) Predicted protein sequence (529 aa)
HaloTag ORF Clone	FHC04625
Flexi ORF Clone	FXC04625
Description	cAMP responsive element binding protein 3-like 2

Features of the cloned cDNA sequence

Description

Length: 7425 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5492 bp
Genome contig ID	gi89161213r_137110267
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CATTTCTTGCAAATAAATATTTTTTCTTAAATAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGATGTTGCCCAGTCTTTATAATCTTGGTACTAATTTGAAAAGCATGTT

Features of the protein sequence

Description

Length: 529 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD79342	2.9e-178	100.0	basic transcrip...	Homo sapiens
ABZ92049	5.5e-178	99.8	cAMP responsive...	synthetic construct
Q70SY1	1.3e-177	99.8	Cyclic AMP-resp...	Homo sapiens
NP_919047	1.5e-177	99.6	cyclic AMP-resp...	Homo sapiens
BAF85737	7.9e-177	99.4	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011616	301	365	PF00170	bZIP transcription factor
HMMSmart	IPR004827	301	365	SM00338	Basic-leucine zipper (bZIP) transcription factor
ProfileScan	IPR004827	303	366	PS50217	Basic-leucine zipper (bZIP) transcription factor
ScanRegExp	IPR004827	308	323	PS00036	Basic-leucine zipper (bZIP) transcription factor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	386	GTCLMVVVLCFAVAFGSFFQGY	407	PRIMARY	22