Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04661
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209756
Product ID ORK04661
Clone name bh00252
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CSRP1
cDNA sequence DNA sequence (5237 bp)
Predicted protein sequence (159 aa)
Description Cysteine and glycine-rich protein 1 (Cysteine-rich protein 1) (CRP1) (CRP).
Features of the cloned cDNA sequence

Length: 5237 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4756 bp
Genome contig ID gi89161185r_199619283
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATTTCTCATCTGGTCAATAAAGCTGTTTAGACCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTCTGGTGTCCAATCCTGTGTCTGTGGAGCTGGGAGGGAACTCAATGG

Features of the protein sequence

Length: 159 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92993 5.1e-69 100.0 cysteine and gl...
Homo sapiens
P97315 1.9e-57 98.5 Cysteine and gl...
Mus musculus
P21291 1.9e-57 98.5 Cysteine and gl...
Homo sapiens
AAV38326 1.9e-57 98.5 cysteine and gl...
synthetic construct
EDL39573 1.9e-57 98.5 cysteine and gl...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001781 8 57 PD000094 Zinc finger
IPR001781 117 136 PD000094 Zinc finger
HMMPfam IPR001781 9 66 PF00412 Zinc finger
HMMSmart IPR001781 8 60 SM00132 Zinc finger
ProfileScan IPR001781 7 67 PS50023 Zinc finger
ScanRegExp IPR001781 9 43 PS00478 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp