Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04680
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209880
Product ID ORK04680
Clone name ef06057
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CUBN
cDNA sequence DNA sequence (7422 bp)
Predicted protein sequence (1327 aa)
Description Cubilin precursor (Intrinsic factor-cobalamin receptor) (Intrinsic factor-vitamin B12 receptor) (460 kDa receptor) (Intestinal intrinsic factor receptor).
Features of the cloned cDNA sequence

Length: 7422 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3437 bp
Genome contig ID gi89161187r_16806827
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCGAGACGGCAAGACTCCATCTC
Flanking genome sequence
(99717 - 99668)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGAAACAAAAAAAACCAGAATCAATATTTGTACATTTTCTC

Features of the protein sequence

Length: 1327 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93117 0 100.0 cubilin variant...
Homo sapiens
EAW86221 0 99.7 cubilin (intrin...
Homo sapiens
O60494 0 99.7 Cubilin; Intrin...
Homo sapiens
AAK61830 0 99.5 intrinsic facto...
Homo sapiens
AAC82612 0 99.5 intrinsic facto...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000859 97 209 PF00431 CUB
IPR000859 216 322 PF00431 CUB
IPR000859 326 434 PF00431 CUB
IPR000859 444 553 PF00431 CUB
IPR000859 567 666 PF00431 CUB
IPR000859 684 794 PF00431 CUB
IPR000859 798 916 PF00431 CUB
IPR000859 923 1037 PF00431 CUB
IPR000859 1042 1151 PF00431 CUB
IPR000859 1158 1268 PF00431 CUB
IPR000859 1276 1326 PF00431 CUB
HMMSmart IPR000859 97 212 SM00042 CUB
IPR000859 216 325 SM00042 CUB
IPR000859 326 440 SM00042 CUB
IPR000859 444 556 SM00042 CUB
IPR000859 558 669 SM00042 CUB
IPR000859 684 797 SM00042 CUB
IPR000859 798 919 SM00042 CUB
IPR000859 923 1040 SM00042 CUB
IPR000859 1042 1154 SM00042 CUB
IPR000859 1158 1271 SM00042 CUB
ProfileScan IPR000859 44 95 PS01180 CUB
IPR000859 97 212 PS01180 CUB
IPR000859 216 325 PS01180 CUB
IPR000859 326 440 PS01180 CUB
IPR000859 444 556 PS01180 CUB
IPR000859 558 669 PS01180 CUB
IPR000859 684 797 PS01180 CUB
IPR000859 798 919 PS01180 CUB
IPR000859 923 1040 PS01180 CUB
IPR000859 1042 1154 PS01180 CUB
IPR000859 1158 1271 PS01180 CUB
IPR000859 1276 1327 PS01180 CUB
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp