ORK04692

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04692

Order Kazusa clone(s) from :

Accession No	AB209617
Product ID	ORK04692
Clone name	sh00386
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CYB5A
cDNA sequence	DNA sequence (5912 bp) Predicted protein sequence (132 aa)
Description	Cytochrome b5.

Features of the cloned cDNA sequence

Description

Length: 5912 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5494 bp
Genome contig ID	gi51511735r_69971512
PolyA signal sequence (AATATA,-21)	+--------+--------+----*----+---- CATGATCTTTTAAAAATATATTTGGCTTTTAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGCACCGTGTTTGCCTGTTTGGTGTATAATTGTCTTTAATGTTTAGAAT

Features of the protein sequence

Description

Length: 132 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92854	5.7e-57	100.0	cytochrome b-5 ...	Homo sapiens
2I96	9.4e-40	91.6	Cytochrome b5	Homo sapiens
P00167	1.1e-39	91.6	Cytochrome b5.	Homo sapiens
XP_001135461	1.5e-39	89.1	similar to Cyto...	Pan troglodytes
AAA52165	2.4e-39	100.0	cytochrome b-5 ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001199	31	117	PD000612	Cytochrome b5
FPrintScan	IPR001199	55	65	PR00363	Cytochrome b5
	IPR001199	65	79	PR00363	Cytochrome b5
	IPR001199	80	87	PR00363	Cytochrome b5
	IPR001199	93	105	PR00363	Cytochrome b5
HMMPfam	IPR001199	32	106	PF00173	Cytochrome b5
ProfileScan	IPR001199	30	106	PS50255	Cytochrome b5
ScanRegExp	IPR001199	61	68	PS00191	Cytochrome b5

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp