Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04735
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209831
Product ID ORK04735
Clone name bm05174
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DEAF1
cDNA sequence DNA sequence (1623 bp)
Predicted protein sequence (348 aa)
Description Deformed epidermal autoregulatory factor 1 homolog (Nuclear DEAF-1- related transcriptional regulator) (NUDR) (Suppressin) (Zinc finger MYND domain-containing protein 5).
Features of the cloned cDNA sequence

Length: 1623 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 575 bp
Genome contig ID gi51511727r_534233
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CGTGTTGTGTCTGTCAATAAAGTGTAAATAAGGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCCCTGCCCCACACGGCCGGTTGCAGTGCCAGCCCTCGGGGGGGGGTTTC

Features of the protein sequence

Length: 348 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93068 3.9e-126 100.0 suppressin vari...
Homo sapiens
BAF82562 3.8e-115 99.6 unnamed protein...
Homo sapiens
AAC79677 4e-115 99.6 nuclear DEAF-1 ...
Homo sapiens
O75398 4.1e-115 99.6 Deformed epider...
Homo sapiens
AAC25716 6.3e-115 99.3 suppressin [Hom...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000770 1 60 PF01342 SAND
IPR002893 291 321 PF01753 Zinc finger
HMMSmart IPR000770 1 60 SM00258 SAND
ProfileScan IPR000770 1 60 PS50864 SAND
IPR002893 291 340 PS50865 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp