Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04766
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209635
Product ID ORK04766
Clone name sh03965
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DGKZ
cDNA sequence DNA sequence (5735 bp)
Predicted protein sequence (380 aa)
Description Diacylglycerol kinase zeta (EC 2.7.1.107) (Diglyceride kinase zeta) (DGK-zeta) (DAG kinase zeta).
Features of the cloned cDNA sequence

Length: 5735 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1526 bp
Genome contig ID gi51511727f_46245455
PolyA signal sequence
(AGTAAA,-23)
+----*----+----*----+----*----+----
TGGGTGTGACTCAGTAAAGTGGATTTTTTTTTCTT
Flanking genome sequence
(113226 - 113275)
----+----*----+----*----+----*----+----*----+----*
TTCTGCTTTTCTTCTTTTGCGGGGGAGGTCTAACAAGCAGCGGGGGCTGC

Features of the protein sequence

Length: 380 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92872 2e-149 100.0 diacylglycerol ...
Homo sapiens
XP_001162432 6.6e-147 99.7 diacylglycerol ...
Pan troglodytes
NP_963291 1.3e-123 99.6 diacylglycerol ...
Homo sapiens
EAW68006 1.4e-123 99.6 diacylglycerol ...
Homo sapiens
AAC50478 1.4e-123 99.6 diacylglycerol ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000756 98 145 PD002939 Diacylglycerol kinase accessory region
HMMPfam IPR000756 3 121 PF00609 Diacylglycerol kinase accessory region
HMMSmart IPR000756 2 121 SM00045 Diacylglycerol kinase accessory region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp