ORK04766

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04766

Order Kazusa clone(s) from :

Accession No	AB209635
Product ID	ORK04766
Clone name	sh03965
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DGKZ
cDNA sequence	DNA sequence (5735 bp) Predicted protein sequence (380 aa)
Description	Diacylglycerol kinase zeta (EC 2.7.1.107) (Diglyceride kinase zeta) (DGK-zeta) (DAG kinase zeta).

Features of the cloned cDNA sequence

Description

Length: 5735 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1526 bp
Genome contig ID	gi51511727f_46245455
PolyA signal sequence (AGTAAA,-23)	+--------+--------+----*----+---- TGGGTGTGACTCAGTAAAGTGGATTTTTTTTTCTT
Flanking genome sequence (113226 - 113275)	----+--------+--------+--------+--------+----* TTCTGCTTTTCTTCTTTTGCGGGGGAGGTCTAACAAGCAGCGGGGGCTGC

Features of the protein sequence

Description

Length: 380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92872	2e-149	100.0	diacylglycerol ...	Homo sapiens
XP_001162432	6.6e-147	99.7	diacylglycerol ...	Pan troglodytes
NP_963291	1.3e-123	99.6	diacylglycerol ...	Homo sapiens
EAW68006	1.4e-123	99.6	diacylglycerol ...	Homo sapiens
AAC50478	1.4e-123	99.6	diacylglycerol ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000756	98	145	PD002939	Diacylglycerol kinase accessory region
HMMPfam	IPR000756	3	121	PF00609	Diacylglycerol kinase accessory region
HMMSmart	IPR000756	2	121	SM00045	Diacylglycerol kinase accessory region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp