ORK04788

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04788

Order Kazusa clone(s) from :

Accession No	AB209252
Product ID	ORK04788
Clone name	fj20077
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DLG2
cDNA sequence	DNA sequence (3926 bp) Predicted protein sequence (555 aa)
Description	Discs large homolog 2 (Postsynaptic density protein PSD-93) (Channel- associated protein of synapse-110) (Chapsyn-110).

Features of the cloned cDNA sequence

Description

Length: 3926 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2019 bp
Genome contig ID	gi51511727r_82919879
PolyA signal sequence (GATAAA,-13)	+--------+--------+----*----+---- TGGCCTTATTCTCATGAAAAGTGATAAAACAGACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGCAAGAAGCAAGGCCTAAGTGAAATTCTTA

Features of the protein sequence

Description

Length: 555 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92489	0	100.0	chapsyn-110 var...	Homo sapiens
EAW75094	1.2e-216	100.0	discs, large ho...	Homo sapiens
Q15700	1.2e-216	100.0	Disks large hom...	Homo sapiens
EAW75093	1.2e-216	100.0	discs, large ho...	Homo sapiens
XP_001175221	2.2e-216	99.6	chapsyn-110 iso...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	111	195	PF00595	PDZ/DHR/GLGF
	IPR001478	206	290	PF00595	PDZ/DHR/GLGF
	IPR001478	434	512	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	119	198	SM00228	PDZ/DHR/GLGF
	IPR001478	214	293	SM00228	PDZ/DHR/GLGF
	IPR001478	442	515	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	111	198	PS50106	PDZ/DHR/GLGF
	IPR001478	206	293	PS50106	PDZ/DHR/GLGF
	IPR001478	434	515	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR000215	380	390	PS00284	Protease inhibitor I4

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp