ORK04794

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04794

Order Kazusa clone(s) from :

Accession No	AB208836
Product ID	ORK04794
Clone name	fg00167
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DMD
cDNA sequence	DNA sequence (6801 bp) Predicted protein sequence (1392 aa)
HaloTag ORF Clone	FHC04794
Flexi ORF Clone	FXC04794
Description	Dystrophin.

Features of the cloned cDNA sequence

Description

Length: 6801 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2620 bp
Genome contig ID	gi89161218r_30947259
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- ATCTCAATAAAGCACGCAGTTATGTTACAAAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATTGACTGGACTGCAGTACTTTGTTTTTATTTTAATTTAGTTGTTGTTA

Features of the protein sequence

Description

Length: 1392 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92073	100.0	dystrophin Dp42...	Homo sapiens
EAW99062	99.8	dystrophin (mus...	Homo sapiens
NP_004013	99.9	dystrophin Dp14...	Homo sapiens
EAW99064	98.9	dystrophin (mus...	Homo sapiens
NP_004003	98.9	dystrophin Dp26...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002017	172	279	PF00435	Spectrin repeat
	IPR002017	282	388	PF00435	Spectrin repeat
	IPR002017	391	504	PF00435	Spectrin repeat
	IPR002017	636	742	PF00435	Spectrin repeat
	IPR001202	759	788	PF00397	WW/Rsp5/WWP
	IPR015153	789	909	PF09068	EF-hand
	IPR015154	913	1004	PF09069	EF-hand
	IPR000433	1009	1054	PF00569	Zinc finger
HMMSmart	IPR002017	175	278	SM00150	Spectrin repeat
	IPR002017	285	387	SM00150	Spectrin repeat
	IPR002017	394	503	SM00150	Spectrin repeat
	IPR002017	510	632	SM00150	Spectrin repeat
	IPR002017	639	741	SM00150	Spectrin repeat
	IPR001202	758	790	SM00456	WW/Rsp5/WWP
	IPR000433	1009	1054	SM00291	Zinc finger
ProfileScan	IPR001202	757	790	PS50020	WW/Rsp5/WWP
ProfileScan	IPR000433	1009	1056	PS50135	Zinc finger
ScanRegExp	IPR001202	763	788	PS01159	WW/Rsp5/WWP
ScanRegExp	IPR000433	1015	1042	PS01357	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp