Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04810
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209834
Product ID ORK04810
Clone name bm05522
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DNAJC7
cDNA sequence DNA sequence (1726 bp)
Predicted protein sequence (483 aa)
Description DnaJ homolog subfamily C member 7 (Tetratricopeptide repeat protein 2) (TPR repeat protein 2).
Features of the cloned cDNA sequence

Length: 1726 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 274 bp
Genome contig ID gi51511734r_37282023
PolyA signal sequence
(ATTAAA,-23)		 
+----*----+----*----+----*----+----
CTGTTTAACTTTATTAAAAAAGAAAAAAAAAAGAG
Flanking genome sequence
(99980 - 99931)		 
----+----*----+----*----+----*----+----*----+----*
AATAAAATGTTTTGACCCTTCCTGGCCCTTTGCTCTGGCATCTGCATTGT

Features of the protein sequence

Length: 483 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93071 4.3e-186 100.0 DnaJ (Hsp40) ho...
 Homo sapiens
AAB36872 1.3e-185 99.7 tetratricopepti...
 Homo sapiens
AAX36741 1.3e-185 99.7 DnaJ-like subfa...
 synthetic construct
Q99615 1.3e-185 99.7 DnaJ homolog su...
 Homo sapiens
BAF83736 2e-185 99.5 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001440 17 50 PF00515 Tetratricopeptide TPR_1
IPR001440 51 84 PF00515 Tetratricopeptide TPR_1
IPR001440 85 118 PF00515 Tetratricopeptide TPR_1
IPR001440 199 232 PF00515 Tetratricopeptide TPR_1
IPR001440 245 278 PF00515 Tetratricopeptide TPR_1
IPR001440 283 316 PF00515 Tetratricopeptide TPR_1
IPR001440 317 350 PF00515 Tetratricopeptide TPR_1
IPR001623 370 437 PF00226 Heat shock protein DnaJ
HMMSmart IPR013026 17 50 SM00028 Tetratricopeptide region
IPR013026 51 84 SM00028 Tetratricopeptide region
IPR013026 85 118 SM00028 Tetratricopeptide region
IPR013026 165 198 SM00028 Tetratricopeptide region
IPR013026 199 232 SM00028 Tetratricopeptide region
IPR013026 245 278 SM00028 Tetratricopeptide region
IPR013026 283 316 SM00028 Tetratricopeptide region
IPR013026 317 350 SM00028 Tetratricopeptide region
IPR001623 369 432 SM00271 Heat shock protein DnaJ
ProfileScan IPR013026 17 50 PS50005 Tetratricopeptide region
IPR013026 17 350 PS50293 Tetratricopeptide region
IPR013026 51 84 PS50005 Tetratricopeptide region
IPR013026 85 118 PS50005 Tetratricopeptide region
IPR013026 131 164 PS50005 Tetratricopeptide region
IPR013026 199 232 PS50005 Tetratricopeptide region
IPR013026 245 278 PS50005 Tetratricopeptide region
IPR013026 283 316 PS50005 Tetratricopeptide region
IPR013026 317 350 PS50005 Tetratricopeptide region
IPR001623 370 440 PS50076 Heat shock protein DnaJ
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp