ORK04836

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04836

Order Kazusa clone(s) from :

Accession No	AB209010
Product ID	ORK04836
Clone name	hg01676
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DUOX2
cDNA sequence	DNA sequence (6641 bp) Predicted protein sequence (550 aa)
Description	Dual oxidase 2 precursor (EC 1.6.3.1) (EC 1.11.1.-) (NADPH oxidase/peroxidase DUOX2) (NADPH thyroid oxidase 2) (Thyroid oxidase 2) (NADH/NADPH thyroid oxidase p138-tox) (p138 thyroid oxidase) (Large NOX 2) (Long NOX 2).

Features of the cloned cDNA sequence

Description

Length: 6641 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1943 bp
Genome contig ID	gi51511731r_43078800
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTCCAGCTTGGGCGAAAGAGTGAGACTCCGTCTC
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAAAGAAATAGGCAGGGCACAATGGCTCACACCTG

Features of the protein sequence

Description

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92247	0	100.0	dual oxidase 2 ...	Homo sapiens
AAF20055	2.8e-203	95.2	NADH/NADPH thyr...	Homo sapiens
EAW77288	3.3e-203	95.2	dual oxidase 2 ...	Homo sapiens
AAF78954	3.3e-203	95.2	putative NADPH ...	Homo sapiens
NP_054799	3.3e-203	95.2	dual oxidase 2 ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	389	446	PD000012	Calcium-binding EF-hand
FPrintScan	IPR001125	389	410	PR00450	Recoverin
	IPR001125	413	432	PR00450	Recoverin
	IPR001125	435	453	PR00450	Recoverin
HMMPfam	IPR002007	49	125	PF03098	Haem peroxidase
	IPR002048	385	413	PF00036	Calcium-binding EF-hand
	IPR002048	421	449	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	385	413	SM00054	Calcium-binding EF-hand
HMMSmart	IPR002048	421	449	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002007	1	145	PS50292	Haem peroxidase
	IPR002048	381	416	PS50222	Calcium-binding EF-hand
	IPR002048	417	452	PS50222	Calcium-binding EF-hand
	IPR002048	461	496	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	394	406	PS00018	Calcium-binding EF-hand
ScanRegExp	IPR002048	430	442	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	161	AITIIALCCLPLVSLLLSGVVAY	183	PRIMARY	23