Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04842
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208997
Product ID ORK04842
Clone name ha06616
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DUSP22
cDNA sequence DNA sequence (2856 bp)
Predicted protein sequence (150 aa)
Description Dual specificity protein phosphatase 22 (EC 3.1.3.48) (EC 3.1.3.16) (JNK-stimulatory phosphatase-1) (JSP-1) (Mitogen-activated protein kinase phosphatase x) (LMW-DSP2).
Features of the cloned cDNA sequence

Length: 2856 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2402 bp
Genome contig ID gi89161210f_190854
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TGTTTTCGTTAATAAAGGGCAACTTAGCCAAGTTT
Flanking genome sequence
(105501 - 105550)
----+----*----+----*----+----*----+----*----+----*
AAGGTCGCGTGCGATGCATTCTTCCCTAGCCAAGGGGCAGTCACCACGCG

Features of the protein sequence

Length: 150 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92234 7e-65 100.0 dual specificit...
Homo sapiens
BAG52670 7.4e-65 100.0 unnamed protein...
Homo sapiens
BAG59068 8.8e-65 100.0 unnamed protein...
Homo sapiens
CAH72535 3.3e-61 100.0 dual specificit...
Homo sapiens
XP_001717853 3.8e-61 100.0 similar to dual...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000340 1 86 PF00782 Protein-tyrosine phosphatase
HMMSmart IPR000340 1 86 SM00195 Protein-tyrosine phosphatase
ProfileScan IPR000340 1 88 PS50054 Protein-tyrosine phosphatase
IPR000387 10 67 PS50056 Protein-tyrosine phosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp