Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04847
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209014
Product ID ORK04847
Clone name hg03819
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DYNC1I2
cDNA sequence DNA sequence (2590 bp)
Predicted protein sequence (575 aa)
Description Cytoplasmic dynein 1 intermediate chain 2 (Dynein intermediate chain 2, cytosolic) (DH IC-2) (Cytoplasmic dynein intermediate chain 2).
Features of the cloned cDNA sequence

Length: 2590 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 520 bp
Genome contig ID gi89161199f_172171646
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TGGTAGTTACCTATAAATAAAAACAAATATGCGTT
Flanking genome sequence
(141521 - 141570)
----+----*----+----*----+----*----+----*----+----*
AACTTTTCAAATTTTCATTTTTACTCCTTACAACTTGAATTTTTCCATCT

Features of the protein sequence

Length: 575 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92251 0 100.0 dynein, cytopla...
Homo sapiens
XP_001144171 0 100.0 hypothetical pr...
Pan troglodytes
XP_860081 0 99.4 similar to Dyne...
Canis lupus fam...
XP_001367904 0 97.9 hypothetical pr...
Monodelphis dom...
AAY24133 0 99.8 unknown [Homo s...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001680 316 348 PF00400 WD40 repeat
IPR001680 403 447 PF00400 WD40 repeat
IPR001680 451 490 PF00400 WD40 repeat
HMMSmart IPR001680 259 298 SM00320 WD40 repeat
IPR001680 305 348 SM00320 WD40 repeat
IPR001680 402 447 SM00320 WD40 repeat
IPR001680 450 490 SM00320 WD40 repeat
IPR001680 495 535 SM00320 WD40 repeat
ProfileScan IPR001680 247 544 PS50294 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp