ORK04861

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04861

Order Kazusa clone(s) from :

Accession No	AB209433
Product ID	ORK04861
Clone name	pj00440
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EHMT2
cDNA sequence	DNA sequence (4068 bp) Predicted protein sequence (1031 aa)
Description	Histone-lysine N-methyltransferase, H3 lysine-9 specific 3 (EC 2.1.1.43) (Histone H3-K9 methyltransferase 3) (H3-K9-HMTase 3) (Euchromatic histone-lysine N-methyltransferase 2) (HLA-B-associated transcript 8) (Protein G9a).

Features of the cloned cDNA sequence

Description

Length: 4068 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	322 bp
Genome contig ID	gi89161210r_31855518
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCCTTTTGTTCTCAATAAATGTTGGGTTTGGTAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGCGATTTTTGTGTTGGGGTGGGGAGAAAGCATACTTGGCTAGAGG

Features of the protein sequence

Description

Length: 1031 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92670	100.0	HLA-B associate...	Homo sapiens
AAH02686	99.3	EHMT2 protein [...	Homo sapiens
AAH20970	99.3	EHMT2 protein [...	Homo sapiens
AAH09351	99.3	EHMT2 protein [...	Homo sapiens
CAQ09159	99.3	euchromatic his...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	499	511	PR01415	Ankyrin
FPrintScan	IPR002110	611	623	PR01415	Ankyrin
HMMPfam	IPR002110	498	530	PF00023	Ankyrin
	IPR002110	531	563	PF00023	Ankyrin
	IPR002110	564	597	PF00023	Ankyrin
	IPR002110	598	630	PF00023	Ankyrin
	IPR002110	638	670	PF00023	Ankyrin
	IPR002110	671	703	PF00023	Ankyrin
	IPR007728	746	851	PF05033	Pre-SET zinc-binding region
	IPR001214	853	983	PF00856	SET
HMMSmart	IPR002110	498	527	SM00248	Ankyrin
	IPR002110	531	560	SM00248	Ankyrin
	IPR002110	564	594	SM00248	Ankyrin
	IPR002110	598	627	SM00248	Ankyrin
	IPR002110	638	667	SM00248	Ankyrin
	IPR002110	671	700	SM00248	Ankyrin
	IPR003606	744	843	SM00468	Pre-SET zinc-binding sub-group
	IPR001214	859	982	SM00317	SET
ProfileScan	IPR002110	468	708	PS50297	Ankyrin
	IPR002110	498	530	PS50088	Ankyrin
	IPR002110	531	563	PS50088	Ankyrin
	IPR002110	564	588	PS50088	Ankyrin
	IPR002110	598	630	PS50088	Ankyrin
	IPR002110	671	703	PS50088	Ankyrin
	IPR007728	793	856	PS50867	Pre-SET zinc-binding region
	IPR001214	858	980	PS50280	SET

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp