Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04879
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209267
Product ID ORK04879
Clone name fk02489
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol EIF4G2
cDNA sequence DNA sequence (3781 bp)
Predicted protein sequence (940 aa)
Description Eukaryotic translation initiation factor 4 gamma 2 (eIF-4-gamma 2) (eIF-4G 2) (eIF4G 2) (p97) (Death-associated protein 5) (DAP-5).
Features of the cloned cDNA sequence

Length: 3781 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 762 bp
Genome contig ID gi51511727r_10675178
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATACTTGTATCTATCAATAAACATTGTGATACTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTAGTGATGTGTGGCTGTAAATGGCATCCATAGTCTGGGAGAATTGTC

Features of the protein sequence

Length: 940 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92504 0 100.0 eukaryotic tran...
Homo sapiens
BAG64064 0 100.0 unnamed protein...
Homo sapiens
XP_001170632 0 99.7 eukaryotic tran...
Pan troglodytes
XP_001093873 0 99.3 eukaryotic tran...
Macaca mulatta
XP_001379555 0 97.2 similar to euka...
Monodelphis dom...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003890 111 341 PF02854 MIF4G-like
IPR003891 577 690 PF02847 Initiation factor eIF-4 gamma
IPR003307 857 938 PF02020 eIF4-gamma/eIF5/eIF2-epsilon
HMMSmart IPR003890 111 341 SM00543 MIF4G-like
IPR003891 577 690 SM00544 Initiation factor eIF-4 gamma
IPR003307 847 933 SM00515 eIF4-gamma/eIF5/eIF2-epsilon
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp