ORK04879

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04879

Order Kazusa clone(s) from :

Accession No	AB209267
Product ID	ORK04879
Clone name	fk02489
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EIF4G2
cDNA sequence	DNA sequence (3781 bp) Predicted protein sequence (940 aa)
Description	Eukaryotic translation initiation factor 4 gamma 2 (eIF-4-gamma 2) (eIF-4G 2) (eIF4G 2) (p97) (Death-associated protein 5) (DAP-5).

Features of the cloned cDNA sequence

Description

Length: 3781 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	762 bp
Genome contig ID	gi51511727r_10675178
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATACTTGTATCTATCAATAAACATTGTGATACTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTAGTGATGTGTGGCTGTAAATGGCATCCATAGTCTGGGAGAATTGTC

Features of the protein sequence

Description

Length: 940 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92504	100.0	eukaryotic tran...	Homo sapiens
BAG64064	100.0	unnamed protein...	Homo sapiens
XP_001170632	99.7	eukaryotic tran...	Pan troglodytes
XP_001093873	99.3	eukaryotic tran...	Macaca mulatta
XP_001379555	97.2	similar to euka...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003890	111	341	PF02854	MIF4G-like
	IPR003891	577	690	PF02847	Initiation factor eIF-4 gamma
	IPR003307	857	938	PF02020	eIF4-gamma/eIF5/eIF2-epsilon
HMMSmart	IPR003890	111	341	SM00543	MIF4G-like
	IPR003891	577	690	SM00544	Initiation factor eIF-4 gamma
	IPR003307	847	933	SM00515	eIF4-gamma/eIF5/eIF2-epsilon

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp