ORK04880

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04880

Order Kazusa clone(s) from :

Accession No	AB209119
Product ID	ORK04880
Clone name	hh13745
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EIF4G3
cDNA sequence	DNA sequence (6193 bp) Predicted protein sequence (1780 aa)
Description	Eukaryotic translation initiation factor 4 gamma 3 (eIF-4-gamma 3) (eIF-4G 3) (eIF4G 3) (eIF-4-gamma II) (eIF4GII).

Features of the cloned cDNA sequence

Description

Length: 6193 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	836 bp
Genome contig ID	gi89161185r_20905563
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- ATAAAGAACAAAATAAAGACAAACATTGCAAGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGAAAGTAAAGTGACTTCTCCTTTGGACAGCTGCTGCATGTGTGCCC

Features of the protein sequence

Description

Length: 1780 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92356	100.0	eukaryotic tran...	Homo sapiens
XP_001165083	99.1	eukaryotic tran...	Pan troglodytes
O43432	99.4	Eukaryotic tran...	Homo sapiens
XP_535377	91.2	similar to euka...	Canis lupus fam...
XP_001256418	92.4	eukaryotic tran...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003890	950	1178	PF02854	MIF4G-like
	IPR003891	1417	1529	PF02847	Initiation factor eIF-4 gamma
	IPR003307	1699	1780	PF02020	eIF4-gamma/eIF5/eIF2-epsilon
HMMSmart	IPR003890	950	1178	SM00543	MIF4G-like
	IPR003891	1417	1529	SM00544	Initiation factor eIF-4 gamma
	IPR003307	1689	1776	SM00515	eIF4-gamma/eIF5/eIF2-epsilon

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp