ORK04939

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04939

Order Kazusa clone(s) from :

Accession No	AB208815
Product ID	ORK04939
Clone name	fj02169
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FABP7
cDNA sequence	DNA sequence (3920 bp) Predicted protein sequence (103 aa)
Description	Fatty acid-binding protein, brain (B-FABP) (Brain lipid-binding protein) (BLBP) (Mammary-derived growth inhibitor related).

Features of the cloned cDNA sequence

Description

Length: 3920 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3559 bp
Genome contig ID	gi89161210f_123042572
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATGTAAATCAAATTTGAATAAAAATCTTACACGTG
Flanking genome sequence (104345 - 104394)	----+--------+--------+--------+--------+----* AAATTTTGTTGTTGTTTCTAATATCATTAATCTGGCTAAGAATTCTATAT

Features of the protein sequence

Description

Length: 103 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92052	1.1e-43	100.0	Hypothetical pr...	Homo sapiens
EAW48165	3.4e-32	100.0	fatty acid bind...	Homo sapiens
CAG33338	3.7e-32	100.0	FABP7 [Homo sap...	Homo sapiens
O15540	3.7e-32	100.0	Fatty acid-bind...	Homo sapiens
CAC21646	4.4e-32	100.0	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000463	11	33	PR00178	Cytosolic fatty-acid binding
FPrintScan	IPR000463	70	86	PR00178	Cytosolic fatty-acid binding
HMMPfam	IPR000566	12	88	PF00061	Lipocalin-related protein and Bos/Can/Equ allergen
ScanRegExp	IPR000463	13	30	PS00214	Cytosolic fatty-acid binding

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp