ORK04987

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04987

Order Kazusa clone(s) from :

Accession No	AB209361
Product ID	ORK04987
Clone name	fh16409
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FAS
cDNA sequence	DNA sequence (5965 bp) Predicted protein sequence (362 aa)
Description	Tumor necrosis factor receptor superfamily member 6 precursor (FASLG receptor) (Apoptosis-mediating surface antigen FAS) (Apo-1 antigen) (CD95 antigen).

Features of the cloned cDNA sequence

Description

Length: 5965 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1322 bp
Genome contig ID	gi89161187f_90619697
PolyA signal sequence (ATTAAA,-7)	+--------+--------+----*----+---- AATTATAAAATATAGGTAAAAGTACGTAATTAAAT
Flanking genome sequence (145814 - 145863)	----+--------+--------+--------+--------+----* AATGTTTTTGGTATTTCTGGTTTTCTCTTTTTTGGTAGGGGCTTGCTTTT

Features of the protein sequence

Description

Length: 362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92598	5.1e-148	100.0	tumor necrosis ...	Homo sapiens
P25445	3.5e-132	99.6	Tumor necrosis ...	Homo sapiens
AAX36193	3.6e-132	99.6	tumor necrosis ...	synthetic construct
AAR08906	6.3e-132	99.3	tumor necrosis ...	Homo sapiens
AAV38887	6.4e-132	99.3	tumor necrosis ...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008063	89	103	PR01680	Fas receptor
	IPR008063	105	115	PR01680	Fas receptor
	IPR008063	127	143	PR01680	Fas receptor
	IPR008063	145	172	PR01680	Fas receptor
	IPR008063	250	265	PR01680	Fas receptor
HMMPfam	IPR001368	112	154	PF00020	TNFR/CD27/30/40/95 cysteine-rich region
	IPR001368	156	192	PF00020	TNFR/CD27/30/40/95 cysteine-rich region
	IPR000488	258	341	PF00531	Death
HMMSmart	IPR001368	76	109	SM00208	TNFR/CD27/30/40/95 cysteine-rich region
	IPR001368	112	154	SM00208	TNFR/CD27/30/40/95 cysteine-rich region
	IPR001368	156	192	SM00208	TNFR/CD27/30/40/95 cysteine-rich region
	IPR000488	245	341	SM00005	Death
ProfileScan	IPR001368	111	154	PS50050	TNFR/CD27/30/40/95 cysteine-rich region
	IPR001368	155	192	PS50050	TNFR/CD27/30/40/95 cysteine-rich region
	IPR000488	257	341	PS50017	Death
ScanRegExp	IPR001368	112	156	PS00652	TNFR/CD27/30/40/95 cysteine-rich region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	196	GSRSNLGWLCLLLLPIPLIVWV	217	PRIMARY	22