Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04994
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208840
Product ID ORK04994
Clone name fh14889
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FBN1
cDNA sequence DNA sequence (4899 bp)
Predicted protein sequence (830 aa)
Description Fibrillin-1 precursor.
Features of the cloned cDNA sequence

Length: 4899 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2404 bp
Genome contig ID gi51511731r_46389576
PolyA signal sequence
(AATAAA,-30)		 
+----*----+----*----+----*----+----
GTCACAATAAAACAATCTCTTCTTTTTTTTAGTTT
Flanking genome sequence
(99987 - 99938)		 
----+----*----+----*----+----*----+----*----+----*
ACCCCTTGGCTTTGTGTTCTTGCATGGATTTGGGGTTGGAGGGGCCATTC

Features of the protein sequence

Length: 830 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92077 0 100.0 fibrillin 1 var...
 Homo sapiens
XP_861706 0 96.7 similar to Fibr...
 Canis lupus fam...
EAW77353 0 100.0 fibrillin 1 (Ma...
 Homo sapiens
BAD16739 0 100.0 fibrillin 1 [Ho...
 Homo sapiens
NP_000129 0 100.0 fibrillin-1 pre...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002212 1 23 PF00683 Matrix fibril-associated
IPR013091 41 81 PF07645 EGF calcium-binding
IPR013091 83 122 PF07645 EGF calcium-binding
IPR002212 139 182 PF00683 Matrix fibril-associated
IPR013091 201 241 PF07645 EGF calcium-binding
IPR013091 243 282 PF07645 EGF calcium-binding
IPR013091 284 324 PF07645 EGF calcium-binding
IPR013091 326 363 PF07645 EGF calcium-binding
IPR013091 365 406 PF07645 EGF calcium-binding
IPR013091 408 446 PF07645 EGF calcium-binding
IPR013091 448 488 PF07645 EGF calcium-binding
IPR002212 503 545 PF00683 Matrix fibril-associated
IPR013091 562 599 PF07645 EGF calcium-binding
IPR013091 601 639 PF07645 EGF calcium-binding
IPR013091 641 680 PF07645 EGF calcium-binding
IPR013091 682 724 PF07645 EGF calcium-binding
IPR013091 726 766 PF07645 EGF calcium-binding
HMMSmart IPR001881 41 82 SM00179 EGF-like calcium-binding
IPR006210 44 82 SM00181 EGF
IPR001881 83 123 SM00179 EGF-like calcium-binding
IPR006210 86 123 SM00181 EGF
IPR001881 201 242 SM00179 EGF-like calcium-binding
IPR006210 204 242 SM00181 EGF
IPR001881 243 283 SM00179 EGF-like calcium-binding
IPR006210 246 283 SM00181 EGF
IPR001881 284 325 SM00179 EGF-like calcium-binding
IPR006210 287 325 SM00181 EGF
IPR001881 326 364 SM00179 EGF-like calcium-binding
IPR006210 329 364 SM00181 EGF
IPR001881 365 407 SM00179 EGF-like calcium-binding
IPR006210 368 407 SM00181 EGF
IPR001881 408 447 SM00179 EGF-like calcium-binding
IPR006210 411 447 SM00181 EGF
IPR001881 448 489 SM00179 EGF-like calcium-binding
IPR006210 451 489 SM00181 EGF
IPR001881 562 600 SM00179 EGF-like calcium-binding
IPR006210 565 600 SM00181 EGF
IPR001881 601 640 SM00179 EGF-like calcium-binding
IPR006210 604 640 SM00181 EGF
IPR001881 641 681 SM00179 EGF-like calcium-binding
IPR006210 644 681 SM00181 EGF
IPR001881 682 725 SM00179 EGF-like calcium-binding
IPR006210 685 725 SM00181 EGF
IPR001881 726 767 SM00179 EGF-like calcium-binding
IPR006210 729 767 SM00181 EGF
ProfileScan IPR000742 41 82 PS50026 EGF-like
IPR000742 83 119 PS50026 EGF-like
IPR000742 201 242 PS50026 EGF-like
IPR000742 243 283 PS50026 EGF-like
IPR000742 284 321 PS50026 EGF-like
IPR000742 326 361 PS50026 EGF-like
IPR000742 365 407 PS50026 EGF-like
IPR000742 408 447 PS50026 EGF-like
IPR000742 448 489 PS50026 EGF-like
IPR000742 562 600 PS50026 EGF-like
IPR000742 601 640 PS50026 EGF-like
IPR000742 641 681 PS50026 EGF-like
IPR000742 682 725 PS50026 EGF-like
IPR000742 726 767 PS50026 EGF-like
ScanRegExp IPR001881 41 66 PS01187 EGF-like calcium-binding
IPR000152 57 68 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 66 81 PS01186 EGF-like region
IPR001881 83 107 PS01187 EGF-like calcium-binding
IPR000152 98 109 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 201 226 PS01187 EGF-like calcium-binding
IPR000152 217 228 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 226 241 PS01186 EGF-like region
IPR001881 243 268 PS01187 EGF-like calcium-binding
IPR000152 259 270 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 268 282 PS01186 EGF-like region
IPR001881 284 309 PS01187 EGF-like calcium-binding
IPR000152 300 311 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 309 324 PS01186 EGF-like region
IPR001881 326 349 PS01187 EGF-like calcium-binding
IPR007087 335 359 PS00028 Zinc finger
IPR000152 340 351 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 349 363 PS01186 EGF-like region
IPR001881 365 391 PS01187 EGF-like calcium-binding
IPR000152 382 393 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 391 406 PS01186 EGF-like region
IPR001881 408 433 PS01187 EGF-like calcium-binding
IPR000152 424 435 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 433 446 PS01186 EGF-like region
IPR001881 448 473 PS01187 EGF-like calcium-binding
IPR000152 464 475 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 473 488 PS01186 EGF-like region
IPR001881 562 586 PS01187 EGF-like calcium-binding
IPR000152 577 588 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 586 599 PS01186 EGF-like region
IPR001881 601 625 PS01187 EGF-like calcium-binding
IPR000152 616 627 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 625 639 PS01186 EGF-like region
IPR001881 641 665 PS01187 EGF-like calcium-binding
IPR000152 656 667 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 665 680 PS01186 EGF-like region
IPR001881 682 709 PS01187 EGF-like calcium-binding
IPR000152 700 711 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 709 724 PS01186 EGF-like region
IPR001881 726 751 PS01187 EGF-like calcium-binding
IPR000152 742 753 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 751 766 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp