Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05006
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209833
Product ID ORK05006
Clone name bm05503
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FBXO9
cDNA sequence DNA sequence (1753 bp)
Predicted protein sequence (554 aa)
Description F-box only protein 9 (Cross-immune reaction antigen 1) (Renal carcinoma antigen NY-REN-57).
Features of the cloned cDNA sequence

Length: 1753 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 69 bp
Genome contig ID gi89161210f_52938177
PolyA signal sequence
(ATTAAA,-34)
+----*----+----*----+----*----+----
AATTAAAGTATATAGCGCAAAAGAGCACCTAAGTT
Flanking genome sequence
(132481 - 132530)
----+----*----+----*----+----*----+----*----+----*
ATAAATGTGTGTGTGTGCGTGTGTGTGTATATATATATATATATATATAT

Features of the protein sequence

Length: 554 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93070 3.8e-198 100.0 F-box only prot...
Homo sapiens
XP_518545 2.1e-197 99.6 hypothetical pr...
Pan troglodytes
XP_001370842 4.4e-155 82.2 hypothetical pr...
Monodelphis dom...
CAB70786 5.7e-154 100.0 hypothetical pr...
Homo sapiens
Q9UK97 1.4e-153 100.0 F-box only prot...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013105 201 234 PF07719 Tetratricopeptide TPR_2
IPR001810 293 345 PF00646 Cyclin-like F-box
ProfileScan IPR001810 292 343 PS50181 Cyclin-like F-box
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp