ORK05007

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05007

Order Kazusa clone(s) from :

Accession No	AB209725
Product ID	ORK05007
Clone name	bm02405
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	FBXW7
cDNA sequence	DNA sequence (1944 bp) Predicted protein sequence (624 aa)
HaloTag ORF Clone	FHC05007
Flexi ORF Clone	FXC05007
Description	F-box/WD repeat protein 7 (F-box and WD-40 domain protein 7) (F-box protein FBX30) (hCdc4) (Archipelago homolog) (hAgo) (SEL-10).

Features of the cloned cDNA sequence

Description

Length: 1944 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	68 bp
Genome contig ID	gi89161207r_153363415
PolyA signal sequence (None)	+--------+--------+----*----+---- GACGATATACTCCCTGCCCTTCCCCCTGCAAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAGAAAAAGAAAAAAATCCCTTGTTCTCAGTGGTGCAGGA

Features of the protein sequence

Description

Length: 624 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92962	100.0	F-box protein F...	Homo sapiens
AAL06291	100.0	archipelago bet...	Homo sapiens
XP_853624	99.8	similar to F-bo...	Canis lupus fam...
BAD97169	99.6	F-box protein F...	Homo sapiens
AAI19947	99.6	F-box and WD re...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	292	323	PD000018	WD40 repeat
	IPR001680	333	364	PD000018	WD40 repeat
	IPR001680	373	405	PD000018	WD40 repeat
	IPR001680	414	444	PD000018	WD40 repeat
	IPR001680	453	485	PD000018	WD40 repeat
	IPR001680	533	568	PD000018	WD40 repeat
FPrintScan	IPR001680	391	405	PR00320	WD40 repeat
	IPR001680	511	525	PR00320	WD40 repeat
	IPR001680	554	568	PR00320	WD40 repeat
HMMPfam	IPR001810	196	243	PF00646	Cyclin-like F-box
	IPR001680	288	324	PF00400	WD40 repeat
	IPR001680	328	364	PF00400	WD40 repeat
	IPR001680	368	404	PF00400	WD40 repeat
	IPR001680	408	444	PF00400	WD40 repeat
	IPR001680	448	484	PF00400	WD40 repeat
	IPR001680	488	524	PF00400	WD40 repeat
	IPR001680	531	567	PF00400	WD40 repeat
HMMSmart	IPR001810	201	241	SM00256	Cyclin-like F-box
	IPR001680	286	324	SM00320	WD40 repeat
	IPR001680	327	364	SM00320	WD40 repeat
	IPR001680	367	404	SM00320	WD40 repeat
	IPR001680	407	444	SM00320	WD40 repeat
	IPR001680	447	484	SM00320	WD40 repeat
	IPR001680	487	524	SM00320	WD40 repeat
	IPR001680	527	567	SM00320	WD40 repeat
	IPR001680	570	618	SM00320	WD40 repeat
ProfileScan	IPR001810	195	241	PS50181	Cyclin-like F-box
	IPR001680	293	576	PS50294	WD40 repeat
	IPR001680	308	333	PS50082	WD40 repeat
	IPR001680	334	373	PS50082	WD40 repeat
	IPR001680	374	413	PS50082	WD40 repeat
	IPR001680	414	453	PS50082	WD40 repeat
	IPR001680	454	493	PS50082	WD40 repeat
	IPR001680	494	533	PS50082	WD40 repeat
	IPR001680	537	576	PS50082	WD40 repeat
ScanRegExp	IPR001680	351	365	PS00678	WD40 repeat
	IPR001680	391	405	PS00678	WD40 repeat
	IPR001680	471	485	PS00678	WD40 repeat
	IPR001680	511	525	PS00678	WD40 repeat
	IPR001680	554	568	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	8	SCICLYCGVLLPVLLPNLPFLTC	30	PRIMARY	23