ORK05020

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05020

Order Kazusa clone(s) from :

Accession No	AB208919
Product ID	ORK05020
Clone name	hk07660
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FGFR1
cDNA sequence	DNA sequence (4157 bp) Predicted protein sequence (814 aa)
Description	Basic fibroblast growth factor receptor 1 precursor (EC 2.7.10.1) (FGFR-1) (bFGF-R) (Fms-like tyrosine kinase 2) (c-fgr) (CD331 antigen).

Features of the cloned cDNA sequence

Description

Length: 4157 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	897 bp
Genome contig ID	gi51511724r_38289406
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AGTTTAGGTCCCTCAATAAAAATTGCTGCTGCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTATCTATGGGCTGTATGAAAAGGGTGGGAATGTCCACTGGAAAGAAG

Features of the protein sequence

Description

Length: 814 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92156	100.0	fibroblast grow...	Homo sapiens
XP_001171246	99.8	fibroblast grow...	Pan troglodytes
AAH15035	99.7	FGFR1 protein [...	Homo sapiens
XP_001492195	99.3	fibroblast grow...	Equus caballus
XP_001171131	99.6	fibroblast grow...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	476	750	PD000001	Protein kinase
FPrintScan	IPR001245	553	566	PR00109	Tyrosine protein kinase
	IPR001245	605	623	PR00109	Tyrosine protein kinase
	IPR001245	654	664	PR00109	Tyrosine protein kinase
	IPR001245	673	695	PR00109	Tyrosine protein kinase
	IPR001245	717	739	PR00109	Tyrosine protein kinase
HMMPfam	IPR013151	42	97	PF00047	Immunoglobulin
	IPR013098	153	241	PF07679	Immunoglobulin I-set
	IPR013151	264	337	PF00047	Immunoglobulin
	IPR001245	470	746	PF07714	Tyrosine protein kinase
HMMSmart	IPR003599	34	113	SM00409	Immunoglobulin subtype
	IPR003598	40	102	SM00408	Immunoglobulin subtype 2
	IPR003599	157	242	SM00409	Immunoglobulin subtype
	IPR003598	163	231	SM00408	Immunoglobulin subtype 2
	IPR003599	256	353	SM00409	Immunoglobulin subtype
	IPR003598	262	342	SM00408	Immunoglobulin subtype 2
	IPR001245	470	746	SM00219	Tyrosine protein kinase
	IPR002290	470	750	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	27	113	PS50835	Immunoglobulin-like
	IPR007110	152	240	PS50835	Immunoglobulin-like
	IPR007110	249	351	PS50835	Immunoglobulin-like
	IPR000719	470	759	PS50011	Protein kinase
ScanRegExp	IPR000719	476	506	PS00107	Protein kinase
ScanRegExp	IPR008266	611	623	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	367	LYLEIIIYCTGAFLISCMVGSVI	389	PRIMARY	23