Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05219
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208826
Product ID ORK05219
Clone name hh00720
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RBFOX1
cDNA sequence DNA sequence (1811 bp)
Predicted protein sequence (304 aa)
Description Ataxin-2-binding protein 1.
Features of the cloned cDNA sequence

Length: 1811 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi51511732f_5909118
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAATGCCAGGCTTCCCGTATCCAGCAGCCACCGCC
Flanking genome sequence
(1734733 - 1734782)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCCTACCGAGGGGCGCACCTGCGAGGCCGCGGTCGCACCGTGTA

Features of the protein sequence

Length: 304 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92063 3.3e-102 100.0 ataxin 2-bindin...
Homo sapiens
CAH91712 7.1e-101 99.0 hypothetical pr...
Pongo abelii
CAH89770 1.7e-86 99.6 hypothetical pr...
Pongo abelii
Q5NVN8 1.7e-86 99.6 Fox-1 homolog A...
Pongo abelii
Q9NWB1 1.8e-86 99.6 Fox-1 homolog A...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 160 229 PF00076 RNA recognition motif
HMMSmart IPR000504 159 230 SM00360 RNA recognition motif
ProfileScan IPR000504 158 234 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp