ORK05274

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05274

Order Kazusa clone(s) from :

Accession No	AB208785
Product ID	ORK05274
Clone name	fk00731
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GART
cDNA sequence	DNA sequence (3391 bp) Predicted protein sequence (1046 aa)
Description	Trifunctional purine biosynthetic protein adenosine-3 [Includes: Phosphoribosylamine--glycine ligase (EC 6.3.4.13) (GARS) (Glycinamide ribonucleotide synthetase) (Phosphoribosylglycinamide synthetase); Phosphoribosylformylglycinamidine cyclo-ligase (EC 6.

Features of the cloned cDNA sequence

Description

Length: 3391 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	157 bp
Genome contig ID	gi51511750r_33698220
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ACTTCATCTATTTTTTTAATAAATAGAGACTCACT
Flanking genome sequence (99924 - 99875)	----+--------+--------+--------+--------+----* AAAAACAAGACTAGTTAGTGCAGCATATCTGAGACATACAGTTTTCTTGG

Features of the protein sequence

Description

Length: 1046 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92022	100.0	phosphoribosylg...	Homo sapiens
BAF85249	100.0	unnamed protein...	Homo sapiens
P22102	99.9	Trifunctional p...	Homo sapiens
AAI07713	99.9	Phosphoribosylg...	Homo sapiens
XP_514869	99.4	phosphoribosylg...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000115	39	140	PF02844	Phosphoribosylglycinamide synthetase
	IPR000115	141	334	PF01071	Phosphoribosylglycinamide synthetase
	IPR000115	369	462	PF02843	Phosphoribosylglycinamide synthetase
	IPR000728	469	630	PF00586	AIR synthase related protein
	IPR010918	642	813	PF02769	AIR synthase related protein
	IPR002376	844	1024	PF00551	Formyl transferase
HMMTigr	IPR000115	39	463	TIGR00877	Phosphoribosylglycinamide synthetase
	IPR004733	471	805	TIGR00878	Phosphoribosylformylglycinamidine cyclo-ligase
	IPR004607	844	1035	TIGR00639	Phosphoribosylglycinamide formyltransferase
ProfileScan	IPR011761	147	354	PS50975	ATP-grasp fold
ScanRegExp	IPR000115	328	335	PS00184	Phosphoribosylglycinamide synthetase
ScanRegExp	IPR001555	976	999	PS00373	Phosphoribosylglycinamide formyltransferase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp