Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05280
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209731
Product ID ORK05280
Clone name ef01127
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GBE1
cDNA sequence DNA sequence (2827 bp)
Predicted protein sequence (754 aa)
Description 1,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Glycogen branching enzyme) (Brancher enzyme).
Features of the cloned cDNA sequence

Length: 2827 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 545 bp
Genome contig ID gi89161205r_81521703
PolyA signal sequence
(TATAAA,-20)
+----*----+----*----+----*----+----
TTATATCCAAGGTAATATAAAAGCCATTACGTATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTCATCCGTGTCTCATTTTGTGTTTTATTTTGTGATCTCTTGTCCACT

Features of the protein sequence

Length: 754 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92968 0 100.0 Glucan , branch...
Homo sapiens
XP_516593 0 99.4 glucan (1,4-alp...
Pan troglodytes
XP_001118968 0 96.1 glucan (1,4-alp...
Macaca mulatta
Q04446 0 100.0 1,4-alpha-gluca...
Homo sapiens
AAH12098 0 99.8 Glucan (1,4-alp...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004193 127 213 PF02922 Glycoside hydrolase
IPR006047 279 340 PF00128 Glycosyl hydrolase
IPR006048 655 750 PF02806 Alpha-amylase
HMMSmart IPR006589 274 620 SM00642 Glycosyl hydrolase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp