Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05300
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209404
Product ID ORK05300
Clone name fh23344
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol GLIS3
cDNA sequence DNA sequence (5257 bp)
Predicted protein sequence (370 aa)
Description Zinc finger protein GLIS3 (GLI-similar 3) (Zinc finger protein 515).
Features of the cloned cDNA sequence

Length: 5257 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4142 bp
Genome contig ID gi89161216r_3714129
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ATTTCATCAGATTTAATTAAAGCTTTTATACATGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTATTGGTTATTCTATTAATCTGCTTCACAAACCGGATAAATGTGTGCT

Features of the protein sequence

Length: 370 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92641 3.5e-113 100.0 GLIS family zin...
Homo sapiens
ABE66435 1.9e-93 97.1 GLIS family zin...
Homo sapiens
Q8NEA6 2.8e-93 97.1 Zinc finger pro...
Homo sapiens
AAH33899 2.8e-93 97.1 GLIS family zin...
Homo sapiens
EAW58787 2.8e-93 97.1 hCG2039673, iso...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 67 91 PF00096 Zinc finger
HMMSmart IPR015880 67 91 SM00355 Zinc finger
ProfileScan IPR007087 67 96 PS50157 Zinc finger
ScanRegExp IPR007087 69 91 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp