ORK05318

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05318

Order Kazusa clone(s) from :

Accession No	AB209283
Product ID	ORK05318
Clone name	fk04825
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GNB3
cDNA sequence	DNA sequence (2870 bp) Predicted protein sequence (327 aa)
Description	Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta 3 (Transducin beta chain 3).

Features of the cloned cDNA sequence

Description

Length: 2870 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	496 bp
Genome contig ID	gi89161190f_6719379
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TAAGACACCTGCAATAAAGTGTAGCACCCTGGTAC
Flanking genome sequence (107442 - 107491)	----+--------+--------+--------+--------+----* ATCTGTGATGTTTGCCTTCTACTCTCTTCTGTTCCAAAAAGACCCAGGTC

Features of the protein sequence

Description

Length: 327 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92520	5.8e-146	100.0	guanine nucleot...	Homo sapiens
P16520	2.9e-143	99.3	Guanine nucleot...	Homo sapiens
AAH00115	1e-142	99.0	Guanine nucleot...	Homo sapiens
XP_591008	2.1e-139	96.5	similar to G-pr...	Bos taurus
P52287	2.1e-139	95.9	Guanine nucleot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	37	71	PD000018	WD40 repeat
	IPR001680	126	158	PD000018	WD40 repeat
	IPR001680	166	200	PD000018	WD40 repeat
	IPR001680	208	242	PD000018	WD40 repeat
	IPR001680	294	327	PD000018	WD40 repeat
FPrintScan	IPR001632	38	54	PR00319	G-protein
	IPR001632	57	71	PR00319	G-protein
	IPR001680	57	71	PR00320	WD40 repeat
	IPR001632	76	91	PR00319	G-protein
	IPR001632	94	111	PR00319	G-protein
	IPR001680	144	158	PR00320	WD40 repeat
	IPR001680	186	200	PR00320	WD40 repeat
HMMPfam	IPR001680	32	70	PF00400	WD40 repeat
	IPR001680	74	112	PF00400	WD40 repeat
	IPR001680	120	157	PF00400	WD40 repeat
	IPR001680	161	199	PF00400	WD40 repeat
	IPR001680	203	241	PF00400	WD40 repeat
	IPR001680	259	285	PF00400	WD40 repeat
	IPR001680	289	327	PF00400	WD40 repeat
HMMSmart	IPR001680	31	70	SM00320	WD40 repeat
	IPR001680	73	112	SM00320	WD40 repeat
	IPR001680	119	157	SM00320	WD40 repeat
	IPR001680	160	199	SM00320	WD40 repeat
	IPR001680	202	241	SM00320	WD40 repeat
	IPR001680	244	285	SM00320	WD40 repeat
	IPR001680	288	327	SM00320	WD40 repeat
ProfileScan	IPR001680	38	79	PS50082	WD40 repeat
	IPR001680	38	327	PS50294	WD40 repeat
	IPR001680	126	166	PS50082	WD40 repeat
	IPR001680	167	208	PS50082	WD40 repeat
	IPR001680	209	250	PS50082	WD40 repeat
	IPR001680	295	327	PS50082	WD40 repeat
ScanRegExp	IPR001680	57	71	PS00678	WD40 repeat
	IPR001680	144	158	PS00678	WD40 repeat
	IPR001680	272	286	PS00678	WD40 repeat
	IPR000560	292	308	PS00778	Histidine acid phosphatase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp