Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05321
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209882
Product ID ORK05321
Clone name ef06292
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GNPAT
cDNA sequence DNA sequence (2405 bp)
Predicted protein sequence (693 aa)
Description Dihydroxyacetone phosphate acyltransferase (EC 2.3.1.42) (DHAP-AT) (DAP-AT) (Glycerone-phosphate O-acyltransferase) (Acyl- CoA:dihydroxyacetonephosphateacyltransferase).
Features of the cloned cDNA sequence

Length: 2405 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 251 bp
Genome contig ID gi89161185f_229343637
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TGTGTTTTAAAATAAACTTTTGGAAACATGTTTGG
Flanking genome sequence
(136527 - 136576)
----+----*----+----*----+----*----+----*----+----*
AAAAGCAAAGCTCAGCTCATTTCACTAACACTTTTCAGCTTACTATATGT

Features of the protein sequence

Length: 693 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93119 0 100.0 glyceronephosph...
Homo sapiens
O15228 0 99.8 Dihydroxyaceton...
Homo sapiens
AAH00450 0 99.7 Glyceronephosph...
Homo sapiens
BAD96493 0 99.7 glyceronephosph...
Homo sapiens
BAG36862 0 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002123 151 296 PF01553 Phospholipid/glycerol acyltransferase
HMMSmart IPR002123 169 298 SM00563 Phospholipid/glycerol acyltransferase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp