Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05331
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209399
Product ID ORK05331
Clone name fh22627
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol GPD2
cDNA sequence DNA sequence (5547 bp)
Predicted protein sequence (728 aa)
Description Glycerol-3-phosphate dehydrogenase, mitochondrial precursor (EC 1.1.99.5) (GPD-M) (GPDH-M) (mtGPD).
Features of the cloned cDNA sequence

Length: 5547 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3234 bp
Genome contig ID gi89161199f_156900442
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
CTGGAAGCATGAATCAATAAAACTGATTAAAATGG
Flanking genome sequence
(250470 - 250519)		 
----+----*----+----*----+----*----+----*----+----*
TCTATTTGCTAGCATTTTGATGTTACTTGCAGTCAGATAACTTTGATTAC

Features of the protein sequence

Length: 728 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92636 0 100.0 glycerol-3-phos...
 Homo sapiens
P43304 0 100.0 Glycerol-3-phos...
 Homo sapiens
AAA65701 0 99.8 mitochondrial g...
 Homo sapiens
XP_001142969 0 99.8 glycerol-3-phos...
 Pan troglodytes
BAF82746 0 99.8 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002048 626 689 PD000012 Calcium-binding EF-hand
FPrintScan IPR000447 71 83 PR01001 FAD-dependent glycerol-3-phosphate dehydrogenase
IPR000447 84 94 PR01001 FAD-dependent glycerol-3-phosphate dehydrogenase
IPR000447 100 112 PR01001 FAD-dependent glycerol-3-phosphate dehydrogenase
IPR000447 152 164 PR01001 FAD-dependent glycerol-3-phosphate dehydrogenase
IPR000447 399 405 PR01001 FAD-dependent glycerol-3-phosphate dehydrogenase
IPR000447 430 442 PR01001 FAD-dependent glycerol-3-phosphate dehydrogenase
HMMPfam IPR006076 72 442 PF01266 FAD dependent oxidoreductase
IPR002048 628 656 PF00036 Calcium-binding EF-hand
IPR002048 664 692 PF00036 Calcium-binding EF-hand
HMMSmart IPR002048 628 656 SM00054 Calcium-binding EF-hand
IPR002048 664 692 SM00054 Calcium-binding EF-hand
ProfileScan IPR002048 624 659 PS50222 Calcium-binding EF-hand
IPR002048 660 695 PS50222 Calcium-binding EF-hand
ScanRegExp IPR000447 76 93 PS00977 FAD-dependent glycerol-3-phosphate dehydrogenase
IPR000447 435 445 PS00978 FAD-dependent glycerol-3-phosphate dehydrogenase
IPR002048 673 685 PS00018 Calcium-binding EF-hand
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp