Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05332
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209806
Product ID ORK05332
Clone name bm03854
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GPKOW
cDNA sequence DNA sequence (1666 bp)
Predicted protein sequence (475 aa)
Description G patch domain and KOW motifs-containing protein (G patch domain- containing protein 5) (Protein MOS2 homolog) (Protein T54).
Features of the cloned cDNA sequence

Length: 1666 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 236 bp
Genome contig ID gi89161218r_48757267
PolyA signal sequence
(AATAGA,-19)
+----*----+----*----+----*----+----
ACCATTTCAAGTACTTAATAGAAAGATGAAATCAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTGGTATGATGAGCTGCGAGTTAAGGTGGGAACTGAGTTGACTGAGGT

Features of the protein sequence

Length: 475 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93043 3.4e-182 100.0 G patch domain ...
Homo sapiens
Q92917 8.9e-182 99.7 G patch domain ...
Homo sapiens
XP_001495277 1.8e-157 86.5 G patch domain ...
Equus caballus
XP_538033 1.6e-147 80.5 similar to G pa...
Canis lupus fam...
XP_001059240 1.2e-133 76.7 similar to G pa...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000467 163 207 PF01585 D111/G-patch
IPR005824 240 273 PF00467 KOW
HMMSmart IPR000467 161 207 SM00443 D111/G-patch
IPR005824 239 266 SM00739 KOW
IPR005824 414 441 SM00739 KOW
ProfileScan IPR000467 163 209 PS50174 D111/G-patch
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp