ORK05430

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05430

Order Kazusa clone(s) from :

Accession No	AB209117
Product ID	ORK05430
Clone name	hh13418
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HLA-A
cDNA sequence	DNA sequence (5420 bp) Predicted protein sequence (393 aa)
Description	HLA class I histocompatibility antigen, A-1 alpha chain precursor (MHC class I antigen A*1).

Features of the cloned cDNA sequence

Description

Length: 5420 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4237 bp
Genome contig ID	gi89161210f_29918312
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACATGAATACTTAAATAAATTTATTTATGCATGT
Flanking genome sequence (107052 - 107101)	----+--------+--------+--------+--------+----* ATGTATGTATGTATTTATTTTATTCATTATATTCACCCCCAGGGTGATTT

Features of the protein sequence

Description

Length: 393 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92354	1.6e-167	100.0	HLA class I his...	Homo sapiens
P30443	2.8e-152	100.0	HLA class I his...	Homo sapiens
CAC44381	7.8e-152	99.7	MHC class I ant...	Homo sapiens
CAH25490	9.1e-152	99.7	MHC class I ant...	Homo sapiens
AAA80569	4.7e-151	99.4	HLA-A-0102 alle...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001039	77	112	PD000050	MHC class I
FPrintScan	IPR001039	82	111	PR01638	MHC class I
	IPR001039	114	130	PR01638	MHC class I
	IPR001039	135	152	PR01638	MHC class I
	IPR001039	180	198	PR01638	MHC class I
HMMPfam	IPR001039	24	202	PF00129	MHC class I
	IPR003597	207	294	PF07654	Immunoglobulin C1-set
	IPR010579	335	363	PF06623	MHC class I
HMMSmart	IPR003597	221	292	SM00407	Immunoglobulin C1-set
ProfileScan	IPR007110	208	294	PS50835	Immunoglobulin-like
ScanRegExp	IPR003006	280	286	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	AVMAPRTLLLLLSGALALTQTWA	23	PRIMARY	23
SOSUI2	2	304	TIPIVGIIAGLVLLGAVITGAVV	326	PRIMARY	23