ORK05438

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05438

Order Kazusa clone(s) from :

Accession No	AB209733
Product ID	ORK05438
Clone name	bm03080
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	HNRNPM
cDNA sequence	DNA sequence (2350 bp) Predicted protein sequence (615 aa)
Description	Heterogeneous nuclear ribonucleoprotein M (hnRNP M).

Features of the cloned cDNA sequence

Description

Length: 2350 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	256 bp
Genome contig ID	gi42406306f_8315884
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCGAATATGACTTTGATAATAAATACCGGTTCCTG
Flanking genome sequence (144112 - 144161)	----+--------+--------+--------+--------+----* AAAACGGCCTGCTTGTGTGTGCTGTGTGGGCAACCACGCGAGGTGTGGGG

Features of the protein sequence

Description

Length: 615 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92970	4e-215	100.0	heterogeneous n...	Homo sapiens
XP_001159225	4.7e-211	99.6	heterogeneous n...	Pan troglodytes
XP_868367	1.2e-210	99.3	similar to hete...	Canis lupus fam...
XP_001158566	1.2e-207	100.0	heterogeneous n...	Pan troglodytes
XP_868354	3.2e-207	99.6	similar to hete...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	288	443	PD112096	NULL
HMMPfam	IPR000504	10	44	PF00076	RNA recognition motif
	IPR000504	106	176	PF00076	RNA recognition motif
	IPR000504	540	609	PF00076	RNA recognition motif
HMMSmart	IPR000504	105	177	SM00360	RNA recognition motif
HMMSmart	IPR000504	539	610	SM00360	RNA recognition motif
ProfileScan	IPR000504	104	181	PS50102	RNA recognition motif
ProfileScan	IPR000504	538	614	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp