ORK05463

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05463

Order Kazusa clone(s) from :

Accession No	AB209534
Product ID	ORK05463
Clone name	fk11001
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HSP90B1
cDNA sequence	DNA sequence (3032 bp) Predicted protein sequence (576 aa)
Description	Endoplasmin precursor (Heat shock protein 90 kDa beta member 1) (94 kDa glucose-regulated protein) (GRP94) (gp96 homolog) (Tumor rejection antigen 1).

Features of the cloned cDNA sequence

Description

Length: 3032 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1301 bp
Genome contig ID	gi89161190f_102748346
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTCATGTGTATAAAAATAAAAAAGATCCCAAATAC
Flanking genome sequence (117491 - 117540)	----+--------+--------+--------+--------+----* TCAGTGTCTTGACTGTCTTGCAGAGAACTACCTAATACTTGGCTGAATTT

Features of the protein sequence

Description

Length: 576 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92771	1.9e-213	100.0	tumor rejection...	Homo sapiens
XP_001158265	8.7e-201	100.0	tumor rejection...	Pan troglodytes
XP_001158432	9.3e-201	100.0	tumor rejection...	Pan troglodytes
XP_001158554	9.4e-201	100.0	tumor rejection...	Pan troglodytes
XP_001158377	9.4e-201	100.0	tumor rejection...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001404	100	120	PR00775	Heat shock protein Hsp90
	IPR001404	121	143	PR00775	Heat shock protein Hsp90
	IPR001404	170	187	PR00775	Heat shock protein Hsp90
	IPR001404	188	205	PR00775	Heat shock protein Hsp90
	IPR001404	218	240	PR00775	Heat shock protein Hsp90
	IPR001404	269	286	PR00775	Heat shock protein Hsp90
	IPR001404	287	305	PR00775	Heat shock protein Hsp90
HMMPfam	IPR003594	122	280	PF02518	ATP-binding region
HMMPfam	IPR001404	283	575	PF00183	Heat shock protein Hsp90
HMMSmart	IPR003594	122	281	SM00387	ATP-binding region
ScanRegExp	IPR001404	120	129	PS00298	Heat shock protein Hsp90

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	25	HAMRALWVLGLCCVLLTFGSVRA	47	PRIMARY	23